Last data update: 24 January 2024 16:39 CET
Plasmid name: pPLc2833 (LMBP 483)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
pplc2833.gb
(View with Genome Compiler) pplc2833.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
- |
| Promoter: | Phage λ major leftward promoter (λ PL) |
| Ribosome binding site: |
- |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
| Parental clone: | pPLc28 |
| Further information: | The plasmid is designed for λ PL promoter-regulated expression of fragments containing a ribosome binding site functional in E. coli. This plasmid carries two BamHI, two SalI and three XbaI expression sites in the polylinker downstream from the λ PL promoter. The PstI expression site is not unique: there is another one in the ampicillin resistance gene. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727045.1. Other name of the plasmid is pST28-33. |
| EMBL Accession number: | LT727045.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 03/04/1989 |
| Sequence detail: | Nucleotide sequence of the polylinker downstream from the PL promoter:
5' GAATTCCGGATCCGGCTCTAGAGGGTCGACCCTCTAGAGGGTCGACCCTCTAGAGGCTGCAGCCGA
EcoRI BamHI XbaI SalI XbaI SalI XbaI PstI
BspMII
CCCCGGATCCGGCCAAGCTT 3'
BamHI HindIII |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: HaeII, PstI and PvuI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr E. Remaut(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Remaut et al., Gene 22 (1983), 103-113 [PMID: 6305768] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 r-m+ (λ) |
| Host reference: | - |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | NCCB 3065 PC-V 3065 |
Refer in your Materials and Methods: |
pPLc2833 (LMBP 483) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr E. Remaut and was published in Remaut et al., 1983. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.