Last data update: 24 January 2024 16:39 CET
Plasmid name: pPLcAT568-Bgal (LMBP 987)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p987.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Escherichia coli lac Z gene (lacZ) |
| Promoter: | Phage λ major leftward promoter (λ PL) |
| Ribosome binding site: |
Ribosome binding site (RBS); synthetic sequence |
| Terminator: | Phage fd terminator |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
| Parental clone: | pPLcAT14-Bgal; pPLcAT568-IFNB |
| Further information: | This plasmid can be used for the expression of fused proteins at the unique sites in lacZ. The plasmid construction is described in publications mentioned above. The nucleotide sequence was composed from these publications.Some minor streches are undefined. |
| EMBL Accession number: | - |
| Latest sequence update: | 06/05/1998 |
| Sequence detail: | Nuceotide sequence of the leader region:
PL promoter -->|
5'...GCGTAGAGGA ATCAGCAGGACGCACTGACCACCATGAAGGTGACGCTCTTAAAATT
AAGCCCTGAAGAAGGGCAGCATTCGACCAAGGAGGTCTAG.ATG.GAT.CCC.GTC.GGT... 3'
BsmI -------- BamHI
SD XbaI
SD: Shine Dalgarno |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr E. Remaut(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Stanssens et al., Gene 36 (1985), 211-223 [PMID: 3000873] |
| Related plasmid reference: | Zabeau et al., EMBO J. 1 (1982), 1217-1224 [PMID: 6327257] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 ΔH1Δtrp |
| Host reference: | Bernard et al., Gene 5 (1979), 59-76 [PMID: 372049] |
| Related host reference: | Remaut et al., Gene 15 (1981), 81-93 [PMID: 6271633] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pPLcAT568-Bgal (LMBP 987) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr E. Remaut and was published in Stanssens et al., 1985. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.