Last data update: 24 January 2024 16:39 CET
Plasmid name: pPSDalphaSfiI/SfiI (LMBP 7310)
| New search | Print data sheet |
| Price category: | Cat. 3 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p7310.gb
(View with Genome Compiler) p7310.txt p7310.pdf |
| Sequence analysis results Genecorner: |
NGS: a12-gc-dec2018.fasta |
| Cloned DNA: |
Saccharomyces cerevisiae α-mating factor 1 gene (MFα1, GeneID 855914); prepro secretion signal sequence (ppMF) Saccharomyces cerevisiae alpha-agglutinin cDNA (SAG1, AG(ALPHA)1, GeneID 853460); C-terminal fragment V5 epitope; C-terminal |
| Promoter: | Pichia pastoris alcohol oxidase 1 promoter (AOX1) |
| Ribosome binding site: |
- |
| Terminator: | Pichia pastoris alcohol oxidase 1 terminator (AOX1) |
| Selection marker: | Ampicillin (amp) Pichia pastoris HIS4; auxotrophic |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli Pichia pastoris; his4(-), integrative |
| Parental clone: | pPSDalphaE-selectin |
| Further information: | The plasmid was constructed by inserting a linker between XhoI and ApaI in pPSDalphaE-selectin, after blunting both ends with T4 DNA polymerase. As a result, the plasmid contains two SfiI restriction sites after the S. cerevisiae ppMF sequence. This P. pastoris surface display vector was adapted for library construction, allowing expression in P. pastoris as an alpha-agglutinin fusion. The C-terminal fragment of SAG1 is highly glycosylated and contains a GPI anchor. |
| EMBL Accession number: | - |
| Latest sequence update: | 03/10/2018 |
| Sequence detail: | The nucleotide sequence of the linker used for the construction of the plasmid:
5' GAAAAGAGAGGCCGAAGCGGCCTAGGGATAACAGGGTAATGGCCGGTGGGGC 3'
SfiI SfiI
BglI BglI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: HincII, NotI/XhoI and PvuI. This plasmid has also been fully sequenced but the NGS sequence data still need to be implemented. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr N. Callewaert(1) (2). (1) Center for Medical Biotechnology, VIB, Ghent, Belgium (2) Department of Biochemistry and Microbiology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Ryckaert et al., J. Biotechnol. 145 (2010), 93-98 [PMID: 19861136] [DOI: 10.1016/j.jbiotec.2009.10.010] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pPSDalphaSfiI/SfiI (LMBP 7310) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr N. Callewaert and was published in Ryckaert et al., 2010. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.