Last data update: 24 January 2024 16:39 CET
Plasmid name: pPTB-HcRED (LMBP 5218)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p5218.gb
(View with Genome Compiler) p5218.txt p5218.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human polypyrimidine tract binding protein 1 cDNA (PTBP1, HNRNP-I, HNRPI, pPTB, PTB-1, PTB2, PTB3, PTB4, GeneID 5725) Heteractis crispa (reef coral) fluorescent protein DNA (HcRed-2A); Far-red mutant (HcRed1) |
| Promoter: | Escherichia coli β-lactamase promoter (amp) Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer Simian virus 40 early promoter (SV40 early) |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli ampicillin resistance gene (amp) |
| Terminator: | Herpes simplex virus (HSV) thymidine kinase polyadenylation signal (TK polyA) |
| Selection marker: | Neomycin (neo; G418; kanamycin (kan)) |
| Replicon: | Phage f1 origin Simian virus 40 bidirectional origin (SV40) Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pEGFP-N3; pHcRed1 |
| Further information: | The plasmid was constructed as follows: 1) first, the pPTB-EGFP vector was made by cloning a BamHI/EcoRI PCR amplicon, containing the human PTBP1 cDNA, in the BamHI/EcoRI opened pEGFP-N3 vector; 2) the HcRed1 coding sequence was obtained by PCR from the pHcRed1 template; 3) finally, the EGFP coding sequence was removed from the pPTB-EGFP vector by digestion with BamHI and HpaI and replaced by the BamHI/HpaI digested HcRed1 amplicon. HcRed1, whose excitation and emission maxima respectively occur at 588 nm and 618 nm (+-)4 nm, was generated by mutagenesis of a non-fluorescent chromoprotein from the reef coral Heteractis crispa (HcRed-2A). The HcRed1 coding sequence has been human codon-optimized for higher expression in mammalian cells. The neomycin resistance cassette, consisting of the SV40 early promoter, the neomycin/kanamycin resistance gene of Tn5, and HSV-TK polyadenylation signals, allows stably transfected eukaryotic cells to be selected using G418. The E. coli β-lactamase promoter upstream of this cassette expresses kanamycin resistance in E. coli. The neomycin resistance coding sequence does not carry the PstI site anymore, neither the BssHII site. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726976.1. The nucleotide sequence of the human PTBP1 cDNA corresponds with the Genbank Nucleotide Sequence Database accession number NM_002819.4. Other name of the plasmid is pcPTB-HcRed. |
| EMBL Accession number: | NM_002819.4, view at GenBank LT726976.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 03/05/2007 |
| Sequence detail: | The primers used in PCR to amplify hPTB were:
forward: 5'CCGAATTCCACCATGGACGGCATTGTCCCAGATATAG 3'
EcoRI
reverse: 5'CGCGGATCCGATGGTGGACTTGGAGAA 3'
BamHI
The primers used in PCR to amplify HcRed were:
forward: 5'CGGGATCCATGGTGAGCGGCCTGCT 3'
BamHI
reverse: 5'GCGTTAACTCAGTTGGCCTTCTCGGGCAG 3'
HpaI *
* Indicates extra nucleotide compared to primer written in Materials and Methods section of Supplementary information related to Schepens et al. (2007) (confirmed by Dr Schepens). |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AccI, BamHI/EcoRI, EcoRI, NaeI and PvuII. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr B. Schepens(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Schepens et al., EMBO J. 26 (2007), 158-169 [PMID: 17159903] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + kanamycin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pPTB-HcRED (LMBP 5218) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. Schepens and Prof. Dr R. Beyaert and was published in Schepens et al., 2007. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.