Last data update: 24 January 2024 16:39 CET
Plasmid name: pSpCas9(BB)-2A-GFP-hCARD9-Ex1 (LMBP 10404)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p10404.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Guide RNA targeting human caspase recruitment domain family member 9 gDNA (CARD9, GeneID 64170) Streptococcus pyogenes CRISPR associated protein 9 cDNA (Cas9) Thosea asigna virus 2A peptide (T2A) SV40 large T-antigen nuclear localization signal (NLS); N-terminal Aequorea victoria green fluorescent protein DNA (GFP); enhanced red-shifted variant (EGFP) FLAG epitope tag; N-terminal |
Promoter: | Human U6 small nuclear RNA gene promoter Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only |
Ribosome binding site: |
- |
Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Bacteriophage M13 origin Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli Mammalian cells |
Parental clone: | pSpCas9(BB)-2A-GFP (PX458) |
Further information: | The plasmid was constructed by cloning the guide RNA sequence for exon 1 of human CARD9 into the pSpCas9(BB)-2A-GFP (PX458) vector. This vector allows for genomic modification in exon 1 of the human CARD9 coding sequence via the CRISPR-Cas9 system. Other name of the plasmid is pX458-hCard9-Ex1. |
EMBL Accession number: | - |
Latest sequence update: | 08/08/2017 |
Sequence detail: | Oligo's used to create the guide RNA for exon 1 of human CARD9: Forward: 5' CACCGCGTGAGGGGTCGATGACCG Reverse: 5' AAACCGGTCATCGACCCCTCACGC |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Ran et al., Nat. Protoc. 8 (2013), 2281-2308 [PMID: 24157548] [DOI: 10.1038/nprot.2013.143] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSpCas9(BB)-2A-GFP-hCARD9-Ex1 (LMBP 10404) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.