Last data update: 24 January 2024 16:39 CET
Plasmid name: pSpCas9(BB)-2A-GFP-hZbtb32 (LMBP 9853)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | not available |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Guide RNA targeting human zinc finger and BTB domain containing 32 (ZBTB32, TZFP, FAZF, FAXF, ROG, ZNF538, GeneID 27033) Streptococcus pyogenes CRISPR associated protein 9 cDNA (Cas9) Thosea asigna virus 2A peptide (T2A) SV40 large T-antigen nuclear localization signal (NLS); N-terminal Aequorea victoria green fluorescent protein DNA (GFP); enhanced red-shifted variant (EGFP) FLAG epitope tag; N-terminal |
| Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Human U6 small nuclear RNA gene promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Bacteriophage M13 origin Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli Mammalian cells |
| Parental clone: | pSpCas9(BB)-2A-GFP (PX458) |
| Further information: | The plasmid was constructed by cloning the guide RNA sequence for exon 1 of human ZBTB32 into the pSpCas9(BB)-2A-GFP (PX458) vector. This vector allows for genomic modification in exon 1 of the human ZBTB32 coding sequence via the CRISPR-Cas9 system. Other name of the plasmid is pX458_T1_Zbtb32. |
| EMBL Accession number: | - |
| Latest sequence update: | 28/10/2019 |
| Sequence detail: | ZBT32 sgRNA targeting primers: Forward: 5' CACCGTGATACTCTGATCACCGTA Reverse: 5' AAACTACGGTGATCAGAGTATCAC |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2) and Dr J. Staal(1) (2). (1) Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSpCas9(BB)-2A-GFP-hZbtb32 (LMBP 9853) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and Dr J. Staal . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.