Last data update: 24 January 2024 16:39 CET
Plasmid name: pTAL-CMV-T7-015339 (LMBP 8947)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p8947.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse receptor-interacting serine-threonine kinase 1 (RIPK1); left transcription activator-like effector nucleases (TALEN) SV40 large T-antigen nuclear localization signal (NLS); N-terminal Influenza HA epitope encoding the haemagglutinin tagging peptide; N-terminal |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer Phage T7 gene 10 promoter (T7g10) |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli Mammalian cells |
| Parental clone: | pCMV |
| Further information: | The plasmid was constructed by cloning the mouse RIPK1 left TALEN into the pCMV vector. Other name of the plasmid is pTAL.CMV-T7.015339. |
| EMBL Accession number: | - |
| Latest sequence update: | 24/08/2016 |
| Sequence detail: | Left TAL Effector DNA-binding domain:TTAGATGAGGAGAAGCC Complete TAL Effector DNA-binding domain:TTAGATGAGGAGAAGCCTCCCTGCCTTCTAGGACCTGTCTGCCTGGAGA |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | The plasmid was deposited by Prof. Dr P. Vandenabeele(1)(2). It was constructed by Dr S. Grootjans(1)(2). (1) Inflammation Research Center, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pTAL-CMV-T7-015339 (LMBP 8947) is available at BCCM/GeneCorner. The plasmid was deposited by Prof. Dr P. Vandenabeele. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.