GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pTAL-CMV-T7-015739 (LMBP 8948)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p8948.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse receptor-interacting serine-threonine kinase 1 (RIPK1); right transcription activator-like effector nucleases (TALEN)
SV40 large T-antigen nuclear localization signal (NLS); N-terminal
Influenza HA epitope encoding the haemagglutinin tagging peptide; N-terminal
Promoter: Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer
Phage T7 gene 10 promoter (T7g10)
Ribosome
binding site:
-
Terminator: Bovine growth hormone polyadenylation signal (BGH polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Mammalian cells
Parental clone: pCMV
Further information: The plasmid was constructed by cloning the mouse RIPK1 right TALEN into the pCMV vector.
Other name of the plasmid is pTAL.CMV-T7.015739.
EMBL Accession number: -
Latest sequence update: 24/08/2016
Sequence detail:
Right TAL Effector DNA-binding domain:ACCTGTCTGCCTGGAGA
Complete TAL Effector DNA-binding domain:TTAGATGAGGAGAAGCCTCCCTGCCTTCTAGGACCTGTCTGCCTGGAGA
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: The plasmid was deposited by Prof. Dr P. Vandenabeele(1)(2). It was constructed by Dr S. Grootjans(1)(2).
(1) Inflammation Research Center, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pTAL-CMV-T7-015739 (LMBP 8948) is available at BCCM/GeneCorner. The plasmid was deposited by Prof. Dr P. Vandenabeele.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search