Last data update: 24 January 2024 16:39 CET
Plasmid name: pUCspaX (LMBP 3120)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | pucspax.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Staphylococcus aureus protein A cDNA (spa); cell-wall-binding region (SPAX) |
| Promoter: | Escherichia coli lac operon promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pUC19 |
| Further information: | This plasmid was constructed as follows: 1) The anchor domain of the protein A gene of S. aureus Cowan I ATCC12598 (LMB2592) was obtained from genomic DNA via PCR. Using the primers 5'- GCTCAGGATCCAAAAGAGGAAGACAACAACAAGCC-3' and 5'-CCGCGTCTAGATATCTATCGTTGTGTATTGTTTGTTTTTATAGTTCGCG-3' respectively, a BamHI site was introduced in front of the start of the anchor domain of the spa gene and a XbaI site was introduced behind the termination codon; 2) This anchor domain was then cloned as a BamHI-XbaI fragment into the BamHI and XbaI sites of pUC19, in the antisene orientation relative to the lac promoter. The spaX fragment can be used for anchoring fused heterologous proteins at the surface of some Gram-positive bacteria (e.g. Staphylococcus, Lactococcus). When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. Restriction enzyme analysis (with StyI) and nucleotide sequence analysis showed that the sequence of the X-domain of the PCR-obtained spa gene corresponds to the sequence of the X-domain of the spa gene of S. aureus Cowan I NCTC8530 instead of ATCC12598. Therefore, the nucleotide sequence of the spa gene of S. aureus Cowan I NCTC8530 obtained from the EMBL Nucleotide Sequence Database accession number M18264 was used to reconstruct the sequence of the plasmid. |
| EMBL Accession number: | - |
| Latest sequence update: | 15/10/1996 |
| Sequence detail: | Nucleotide sequence at the start of the spa gene and following its termination codon:
---> pUC19 ---> spa anchor(X region)
5' GAATTCGAGCTCGGTACCCGGGGATCC A.AAA.GAG.GAA.GAC. ... .GAA.CTA.TAA
EcoRI SacI KpnI BamHI ^ *
ApoI HgiJII AvaI
SmaI
---> pUC19
AAACAAACAATACACAACGATAGATATC TAGAGTCGACCTGCAGGCATGCAAGCTT 3'
BsaBI XbaI HindII SphI HindIII
EcoRV SalI PstI
AccI
BspMI
^: Nucleotide position 978 of the spa coding sequence.
*: Termination codon of the spa gene.
Punctuation indicates reading frame. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by J. Viaene(1) (2) and Prof. Dr E. Remaut(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Sjödahl, Eur. J. Biochem. 78 (1977), 471-490 [PMID: 913410] Shuttleworth et al., Gene 58 (1987), 283-295 [PMID: 2828190] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 RR1ZΔM15 |
| Host reference: | Altieri et al., J. Bacteriol. 168 (1986), 648-654 [PMID: 2946661] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pUCspaX (LMBP 3120) is available at BCCM/GeneCorner. This plasmid was deposited by J. Viaene and Prof. Dr E. Remaut . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.