Last data update: 24 January 2024 16:39 CET
Plasmid name: pUHD-2FKBP-link-hFADD-DN (LMBP 4601)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p4601.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human Fas receptor-associated death domain cDNA (FADD); dominant negative part (DN) Human FK506-binding protein prolyl isomerase 1A cDNA (FKBP1A, FKBP-12, FKBP12C, PKC12, PPIASE, GeneID 2280) Rous sarcoma virus (RSV) tyrosine kinase gene (v-src); myristoylation-targeting sequence, N-terminal GSGGGS linker; N-terminal Influenza HA epitope encoding the haemagglutinin tagging peptide; C-terminal |
Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE); minimal promoter with tet operator (CMVT) |
Ribosome binding site: |
- |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli; preferably recombination-deficient strains Mammalian cells; use strains expressing a tetracycline-controlled transcriptional activator |
Parental clone: | pUHD10-3 |
Further information: | The plasmid contains the hFADD-DN coding sequence fused to the N-terminal v-src myristoylation-targeting sequence, the N-terminal tandem repeat of hFKBP1A, the N-terminal GSGGGS linker and the C-terminal HA epitope. The hFADD-DN insert encodes amino acid 80 to 208, containing the death domain (DD) defined from codon 101 to 179. The plasmid is designed for tetracycline controlled expression of the fusion protein under control of the hCMVT promoter in Tet-Off and Tet-On gene expression systems and cell lines. The hCMVT promoter is composed of a minimal hCMV-IE promoter preceded by the Tet-responsive element (TRE), which consists of seven copies of the 42 bp tetracycline operator O2 of E. coli Tn10 (tetO), which contain each a 19 bp inverted repeat sequence. The hCMVT promoter is responsive to the tTA and rtTA regulatory proteins in the Tet-Off and Tet-On systems, respectively. tTA (tet-controlled transcriptional activator) is a fusion of the wild-type Tet repressor (TetR) to the VP16 activation domain (AD) of Herpes simplex. tTA binds the tetO sequence and thereby activates transcription in the absence of tetracycline. Reverse tTA (rtTA) is a fusion of rTetR, which differs from the wild-type TetR by four amino acid exchanges, to VPad and activates transcription in the presence of doxycyclin (a tetracycline derivative). hFKBP1A is a member of the immunophilin protein family, which plays a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. The fusion protein can be dimerized upon AP1510 (synthetic analogue of FK1012 ligand) administration. The v-src myristoylation-targeting sequence directs the fusion protein to cellular membranes. The nucleotide sequence of the hFADD cDNA corresponds with the EMBL Nucleotide Sequence Database accession number U24231.1. |
EMBL Accession number: | U24231.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 26/03/2008 |
Sequence detail: | Nucleotide sequence of the hCMVT promoter: ------------------------------- hCMVT promoter ----------- Tet-responsive element ----------> 5' (GAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTC)x7 --------- --------- inverted repeat hCMVT promoter --------------------------------------------------------> GAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCG SacI SmaI ^ ------- KpnI StuI ------------ mRNA -----------> TCAGATCGCCTGGAGACGCCATCCACGCT ... 3' ^: mutated nucleotide at position -31. |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by G. Van Loo(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Vanden Berghe et al., J. Biol. Chem. 279 (2004), 7925-7933 [PMID: 14668343] |
Related plasmid reference: | Gossen et al., Proc. Natl. Acad. Sci. U.S.A. 89 (1992), 5547-5551 [PMID: 1319065] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pUHD-2FKBP-link-hFADD-DN (LMBP 4601) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele and was published in Vanden Berghe et al., 2004. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.