Last data update: 24 January 2024 16:39 CET
Plasmid name: pUHD-hFADD-DED (LMBP 4595)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p4595.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human Fas receptor-associated death domain cDNA (FADD); part containing the death effector domain (DED) E-tag; C-terminal |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE); minimal promoter with tet operator (CMVT) |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli; preferably recombination-deficient strains Mammalian cells; use strains expressing a tetracycline-controlled transcriptional activator |
| Parental clone: | pUHD10-3; pcDNA1-hFADD-DED |
| Further information: | The plasmid is designed for tetracycline controlled expression of hFADD-DED, fused to the C-terminal E-tag, under control of the hCMVT promoter in Tet-Off and Tet-On gene expression systems and cell lines. The hFADD-DED insert encodes amino acid 1 to 111, containing the death effector domain defined from codon 27 to 60. The N-terminal DED-domain of hFADD allows the recruitment of caspase-8, and thereby the activation of the cysteine protease cascade. The hCMVT promoter is composed of a minimal hCMV-IE promoter preceded by the Tet-responsive element (TRE), which consists of seven copies of the 42 bp tetracycline operator O2 of E. coli Tn10 (tetO), which contain each a 19 bp inverted repeat sequence. The hCMVT promoter is responsive to the tTA and rtTA regulatory proteins in the Tet-Off and Tet-On systems, respectively. tTA (tet-controlled transcriptional activator) is a fusion of the wild-type Tet repressor (TetR) to the VP16 activation domain (AD) of Herpes simplex. tTA binds the Tet operator sequence (tetO) and thereby activates transcription in the absence of tetracycline. Reverse tTA (rtTA) is a fusion of rTetR (differs from the wild-type TetR by four amino acid exchanges) to VPad and activates transcription in the presence of doxycyclin (a tetracycline derivative). The nucleotide sequence of the hFADD cDNA corresponds with the EMBL Nucleotide Sequence Database accession number U24231.1. Other name of the plasmid is pUHD-hDED/FADD. |
| EMBL Accession number: | U24231.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 02/02/2004 |
| Sequence detail: | Nucleotide sequence of the hCMVT promoter:
------------------------------- hCMVT promoter
----------- Tet-responsive element ---------->
5' (GAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTC)x7
--------- ---------
inverted repeat
hCMVT promoter -------------------------------------------------------->
GAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCG
SacI SmaI ^ -------
KpnI StuI
------------ mRNA ----------->
TCAGATCGCCTGGAGACGCCATCCACGCT ... 3'
^: mutated nucleotide at position -31.
Nucleotide sequence of the fusion gene:
-------------- hFADD fragment ------------>
--- DED domain --->
1 2 27 28 59 60 110 111 ---
5' ... CTTATCATCGATAAGCTTCCGCC.ATG.GAC ... TGC.CTC ... CAC.ACC ... AAA.GAT.GCG.GCC.GCA.GGT
HindIII Met Asp Cys Leu His Thr Lys Asp Ala Ala Ala Gly
*** NotI
NcoI
------------------ E-tag --------------------->
GCG.CCG.GTG.CCG.TAT.CCG.GAT.CCG.CTG.GAA.CCG.CGT.GCC.GCA.TAG.ACTGTTGAAAGTTGTTTAGC ... 3'
Ala Pro Val Pro Tyr Pro Asp Pro Leu Glu Pro Arg Ala Ala +++
BamHI
***: start codon.
+++: termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by G. Van Loo(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Gossen et al., Proc. Natl. Acad. Sci. U.S.A. 89 (1992), 5547-5551 [PMID: 1319065] Vanden Berghe et al., J. Biol. Chem. 279 (2004), 7925-7933 [PMID: 14668343] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pUHD-hFADD-DED (LMBP 4595) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.