GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pUHD-mBAX (LMBP 4608)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p4608.gb (View with Genome Compiler)
p4608.txt
p4608.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse Bcl2-associated X cDNA (Bax, BAX); α variant
Promoter: Human cytomegalovirus immediate early promoter (CMV-IE); minimal promoter with tet operator (CMVT)
Ribosome
binding site:
-
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli; preferably recombination-deficient strains
Mammalian cells; use strains expressing a tetracycline-controlled transcriptional activator
Parental clone: pUHD10-3
Further information: The plasmid was constructed by inserting the 589 bp EcoRI/XbaI fragment, containing the mBAX coding sequence, into the EcoRI/XbaI opened pUHD10-3 vector.
pUHD-mBAX is a response plasmid that was designed for tetracycline-controlled expression of mBAX under control of the hCMVT promoter in Tet-Off and Tet-On gene expression systems and cell lines (i.e. carrying a regulator plasmid).
The hCMVT promoter is composed of a minimal hCMV-IE promoter preceded by the Tet-responsive element (TRE), that consists of seven copies of the 42 bp tetracycline operator O2 of E. coli Tn10 (tetO), each containing a 19 bp inverted repeat sequence.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727124.1.
The nucleotide sequence of the mBAX cDNA corresponds with the EMBL Nucleotide Sequence Database accession number L22472.1.
The nucleotide sequence of the pUHD10-3 vector part of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number U89931.1, except for the 'T' nucleotide at position 2703 of pUHD10-3 which was changed into a 'C' to create the extra HincII site that was experimentally determined in pUHD-mBAX.
EMBL Accession number: L22472.1, view at EMBL, GenBank, DDBJ
U89931.1, view at EMBL, GenBank, DDBJ
LT727124.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 19/01/2009
Sequence detail:
Nucleotide sequence of the hCMVT promoter:

   ------------------------------- hCMVT promoter
   ----------- Tet-responsive element ---------->
5' (TCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAG)x7
                 --------- ---------
                  inverted repeat


    hCMVT promoter ---------------------------------------------------------->
    TCGAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCG
      SacI      SmaI      *                    ^                             @
            KpnI                            StuI

    ------------ mRNA ----------->
    TCAGATCGCCTGGAGACGCCATCCACGCT ... 3'

*: -53 position.
^: mutated nucleotide at position -31.
@: -1 position.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: Alw44I/PvuI, Eco147I/PvuII, EcoRI/HincII, EcoRI/XbaI, HincII, HincII/KpnI, KpnI, NotI/PstI and XhoI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by G. Van Loo(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Gossen et al., Proc. Natl. Acad. Sci. U.S.A. 89 (1992), 5547-5551 [PMID: 1319065]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pUHD-mBAX (LMBP 4608) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search