Last data update: 24 January 2024 16:39 CET
Plasmid name: pUHD-mBAX (LMBP 4608)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p4608.gb
(View with Genome Compiler) p4608.txt p4608.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse Bcl2-associated X cDNA (Bax, BAX); α variant |
Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE); minimal promoter with tet operator (CMVT) |
Ribosome binding site: |
- |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli; preferably recombination-deficient strains Mammalian cells; use strains expressing a tetracycline-controlled transcriptional activator |
Parental clone: | pUHD10-3 |
Further information: | The plasmid was constructed by inserting the 589 bp EcoRI/XbaI fragment, containing the mBAX coding sequence, into the EcoRI/XbaI opened pUHD10-3 vector. pUHD-mBAX is a response plasmid that was designed for tetracycline-controlled expression of mBAX under control of the hCMVT promoter in Tet-Off and Tet-On gene expression systems and cell lines (i.e. carrying a regulator plasmid). The hCMVT promoter is composed of a minimal hCMV-IE promoter preceded by the Tet-responsive element (TRE), that consists of seven copies of the 42 bp tetracycline operator O2 of E. coli Tn10 (tetO), each containing a 19 bp inverted repeat sequence. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727124.1. The nucleotide sequence of the mBAX cDNA corresponds with the EMBL Nucleotide Sequence Database accession number L22472.1. The nucleotide sequence of the pUHD10-3 vector part of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number U89931.1, except for the 'T' nucleotide at position 2703 of pUHD10-3 which was changed into a 'C' to create the extra HincII site that was experimentally determined in pUHD-mBAX. |
EMBL Accession number: | L22472.1, view at EMBL, GenBank, DDBJ U89931.1, view at EMBL, GenBank, DDBJ LT727124.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 19/01/2009 |
Sequence detail: | Nucleotide sequence of the hCMVT promoter: ------------------------------- hCMVT promoter ----------- Tet-responsive element ----------> 5' (TCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAG)x7 --------- --------- inverted repeat hCMVT promoter ----------------------------------------------------------> TCGAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCG SacI SmaI * ^ @ KpnI StuI ------------ mRNA -----------> TCAGATCGCCTGGAGACGCCATCCACGCT ... 3' *: -53 position. ^: mutated nucleotide at position -31. @: -1 position. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: Alw44I/PvuI, Eco147I/PvuII, EcoRI/HincII, EcoRI/XbaI, HincII, HincII/KpnI, KpnI, NotI/PstI and XhoI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by G. Van Loo(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Gossen et al., Proc. Natl. Acad. Sci. U.S.A. 89 (1992), 5547-5551 [PMID: 1319065] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pUHD-mBAX (LMBP 4608) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.