Last data update: 24 January 2024 16:39 CET
Plasmid name: pUHDE6Hy3f2ANG (LMBP 3560)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p3560.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse anti-hPLAP monoclonal antibody E6(Hy3,κ) cDNA; truncated mouse::human chimeric heavy chain of the F(ab')2 fragment E6(Hy3,κ)F2 (E6Hy3f2) Human angiogenin gene (hANG); mature sequence |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE); minimal promoter with tet operator (CMVT) |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli; preferably recombination-deficient strains Mammalian cells; use strains expressing a tetracycline-controlled transcriptional activator |
| Parental clone: | pUHDE6Hy3f2ETA |
| Further information: | The plasmid was constructed by inserting the mature human angiogenin gene as a MluI-XbaI fragment into the MluI-XbaI opened pUHDE6Hy3f2ETA plasmid. This fragment was derived from genomic human colon carcinoma DNA via PCR. The hCMVT promoter is composed of a minimal hCMV-IE promoter preceded by the Tet-responsive element (TRE), which consists of seven copies of the 42 bp tetracycline operator O2 of E. coli Tn10 (tetO), which contain each a 19 bp inverted repeat sequence. pUHDE6Hy3f2ANG is an expression vector for the heavy chain of a mouse::human immunotoxin in mammalian cells. This plasmid has to be used in combination with an E6L (light chain of the mouse monoclonal antibody E6(IgG2b,κ)) expression vector (e.g. pCAGGSE6L) to produce a hPLAP (human placental alkaline phosphatase) -specific mouse::human chimeric immunotoxin. Cotransfection with pUHD15-1, pUHG17-1 or pUHD172-1neo is necessary for tetracycline controlled gene expression in mammalian cells. The fusion between the E6Hy3f2 sequence and the mature human angiogenin sequence is characterized by an acid protease (cathepsin)-sensitive Asp-(Ala-Leu)2 linker. The nucleotide sequence of the mature human angiogenin gene corresponds with the EMBL Nucleotide Sequence Database accession number M11567.1. Other name of the plasmid is pUHD10-3E6Hy3f2Ang. |
| EMBL Accession number: | M11567.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 25/11/1996 |
| Sequence detail: | Primers used to amplify hANG cds:
Forward: 5' CGCGGACGCGTTAGCGCTCGCCCAGGATAACTCCAGGTACACACACTTCCT
Reverse: 5' CACAGCTCTAGATTACGGACGACGGAAAATTGACTG
Nucleotide sequence of the hCMVT promoter:
------------------------------- hCMVT promoter
----------- Tet-responsive element ---------->
5' (GAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTC)x7
--------- ---------
inverted repeat
hCMVT promoter -------------------------------------------------------->
GAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCG
SacI SmaI ^ -------
KpnI StuI
------------ mRNA ----------->
TCAGATCGCCTGGAGACGCCATCCACGCT ... 3'
^: mutated nucleotide at position -31.
Nucleotide sequence at the E6Hy3f2-ANG fusion:
> hinge|--> part CH2 + linker
5' TGC.CCA.GCA.CCT.GAA.CTC.TTG. ... .CCT.GAC.TTA.GTT.GAC.GCG.
Ser Pro Ala Pro Glu Leu Leu Pro Asp Leu Val Asp Ala
MluI
|--> mature human angiogenin gene
TTA.GCG.CTC.GCC.CAG.GAT.AAC.TCC. 3'
Leu Ala Leu Ala Gln Asp Asn Ser
Punctuation indicates reading frame.
Mutated sequence at the end of the leader signal of the E6Hy3f2 gene on this plasmid:
--> Leader |--> Variable region
Val Gln Ser Gln Val Gln
Wild type E6Hy3f2: 5' GTC.CAA.TCC.CAG.GTT.CAG. 3'
--> Leader |--> Variable region
Val Arg Tyr Gln Val Gln
Mutated E6Hy3f2: 5' GTC.CGG.TAC.CAG.GTT.CAG. 3'
^^ ^
KpnI
^: Mutated nucleotide.
Punctuation indicates reading frame. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr N. Callewaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Kurachi et al., Biochemistry 24 (1985), 5494-5499 [PMID: 2866795] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pUHDE6Hy3f2ANG (LMBP 3560) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr N. Callewaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.