Last data update: 24 January 2024 16:39 CET
Plasmid name: pVIK165 (LMBP 4119)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4119.gb
(View with Genome Compiler) p4119.txt p4119.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Aequorea victoria green fluorescent protein DNA (GFP); mutated sequence |
| Promoter: | - |
| Ribosome binding site: |
Ribosome binding site (RBS); synthetic sequence |
| Terminator: | - |
| Selection marker: | Neomycin (neo; kanamycin (kan)) |
| Replicon: | Escherichia coli plasmid R6K origin; defective pir gene Broad-host-range plasmid RK2/RP4 origin of transfer (oriT) |
| Host range: | Escherichia coli; use strains supplying the R6K pir function Gram-negative bacterial strains |
| Parental clone: | pVIK108; pTB93F |
| Further information: | This plasmid was constructed as follows: 1) pVIK107 was digested with SalI and Psp1406I (AclI); 2) the resulting fragments were filled in with T4 DNA polymerase and ligated again, screening for a plasmid, pVIK108, that lacks the lacZ gene and contains the neomycin resistance gene and the R6K and RP4 derived segments as present in pVIK107. Because of the ligation, the original SalI site was restored in pVIK108; 3) the SalI fragment from pTB93F, containing the mutated GFP sequence, was inserted into the SalI site from pVIK108, resulting in pVIK165. pVIK165 contains a variant of GFP containing a threonine residue at amino acid position 65 instead of the wild type serine residue. It also incorporates a prokaryotic ribosome binding site. pVIK165 is a suicide vector designed to create transcriptional fusions between chromosal or plasmid-encoded genes and the GFP reporter gene. This plasmid can be used to measure transcriptional regulation of particular promoters. Introduce the plasmid by electroporation, or through conjugation, using plasmid RK2/RP4 transfer functions (provided in trans by RK2/RP4, RK2/RP4-derived vectors, other replicons carrying RK2/RP4 transfer functions (e.g. pRK2073) or E. coli strains expressing the tra genes of RK2/RP4 (e.g. S17-1(λpir)). The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727311.1. The nucleotide sequence of the wild type GFP cds corresponds with the EMBL Nucleotide Sequence Database accession number E17099.1. This was confirmed by the GeneCorner results obtained from the sequence analysis of the region between the R6K ori and the Tn5 neomycin resistance. |
| EMBL Accession number: | E17099.1, view at EMBL, GenBank, DDBJ LT727311.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 07/09/2012 |
| Sequence detail: | Nucleotide sequence of the multicloning site:
5' ... GAATTCCCGGGAGAGCTCGATATCGCATGCGGTACCTCTAGAAGAAGCTTG
SacI EcoRV KpnI XbaI
GGATCCGTCGACCTCGAATTCGGAGGAAACAAAG.ATG.AGT.AAA ... 3'
------ ***
*: start codon of the GFP coding sequence.
-: prokaryotic ribosome binding site.
Punctuation indicates reading frame.
Nucleotide sequence of the mutated GFP gene:
65
wild type GFP: 5' ... ACT.TTC.TCT.TAT.GGT ... 3'
Thr Phe Ser Tyr Gly
65
mutated GFP: 5' ... ACT.TTC.ACT.TAT.GGT ... 3'
^
Thr Phe Thr Tyr Gly
^: mutated nucleotide.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/PvuII, HindIII, SalI and XbaI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr S.C. Winans(1). It was constructed by Dr V.S. Kalogeraki(1). (1) Section of Microbiology, Cornell University, Ithaca, USA |
| Plasmid reference: | Kalogeraki et al., Gene 188 (1997), 69-75 [PMID: 9099861] |
| Related plasmid reference: | De Mey et al., BMC Biotechnol. 7 (2007), 34 [PMID: 17572914] [DOI: 10.1186/1472-6750-7-34] Gage et al., J. Bacteriol. 178 (1996), 7159-7166 [PMID: 8955397] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 S17-1(λpir) |
| Host reference: | Tascon et al., J. Bacteriol. 175 (1993), 5717-5722 [PMID: 8396122] [DOI: 10.1128/jb.175.17.5717-5722.1993] |
| Related host reference: | Kalogeraki et al., Gene 188 (1997), 69-75 [PMID: 9099861] Simon et al., Biotechnology 1 (1983), 784-791 [DOI: 10.1038/nbt1183-784] |
| Cultivation medium: | LB-Lennox + kanamycin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pVIK165 (LMBP 4119) is available at BCCM/GeneCorner. This plasmid was deposited by Dr S.C. Winans and was published in Kalogeraki et al., 1997. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.