Last data update: 24 January 2024 16:39 CET
Plasmid name: pX330-hTRAF2-CRISPR-GeCKO-1A (LMBP 9412)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | not available |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Guide RNA targeting human TNF receptor associated factor 2 gDNA (TRAF2, TRAP3, RNF117, GeneID 7186) Streptococcus pyogenes CRISPR associated protein 9 cDNA (Cas9); modified sequence SV40 large T-antigen nuclear localization signal (NLS); N-terminal FLAG epitope tag; N-terminal |
Promoter: | Human U6 small nuclear RNA gene promoter Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Chicken β-actin promoter (ACTB) |
Ribosome binding site: |
- |
Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Phage f1 origin Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli Mammalian cells |
Parental clone: | pX330 |
Further information: | The plasmid was constructed by cloning the synthetic human TRAF2 CRISPR gRNA fragment into the Bbs1 opened pX330 vector. The sequence of the human TRAF2 CRISPR guide RNA was obtained from the BROAD Genome wide CRISPR Knock-Out library (GeCKO). The S. pyogenes Cas9 coding sequence was codon optimised for expression in human cell lines. Other name of the plasmid is pX330 TRAF2 CRISPR GECKO 1A. |
EMBL Accession number: | - |
Latest sequence update: | 20/03/2017 |
Sequence detail: | Sequence of the human TRAF2 CRISPR guide RNA: GACCGAATGTCCCGCGTGCAA |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | The plasmid was deposited by Prof. Dr R. Beyaert(1)(2). It was constructed by Dr. N. Harper(3). (1) Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium (3) Institute of Translational Medicine, University of Liverpool, Liverpool, United Kingdom |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pX330-hTRAF2-CRISPR-GeCKO-1A (LMBP 9412) is available at BCCM/GeneCorner. The plasmid was deposited by Prof. Dr R. Beyaert. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.