Last data update: 24 January 2024 16:39 CET
Plasmid name: pX335-hMALT1-Exon1-CRISPR-2For (LMBP 9453)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | not available |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Guide RNA targeting human MALT1 paracaspase gDNA (MALT1, MLT, PCASP1, paracaspase 1, GeneID 10892) Streptococcus pyogenes CRISPR associated protein 9 cDNA (Cas9); mutated modified sequence SV40 large T-antigen nuclear localization signal (NLS); N-terminal Influenza HA epitope encoding the haemagglutinin tagging peptide; N-terminal |
Promoter: | Human U6 small nuclear RNA gene promoter Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Chicken β-actin promoter (ACTB) |
Ribosome binding site: |
- |
Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
Host range: | Escherichia coli Mammalian cells |
Parental clone: | pX335 |
Further information: | The plasmid was constructed by cloning the synthetic human MALT1 CRISPR gRNA fragment into the Bbs1 opened pX335 vector. This CRISPR genome editing plasmid encodes the nickase Cas9 (D10A mutant) and targets exon 1 of the human MALT1 coding sequence. The plasmid is meant to be used in combination with pX335-hMALT1-Exon1-CRISPR-2Rev but can also be combined with pX335-hMALT1-Exon1-CRISPR-3Rev. Other name of the plasmid is pX335 MALT1 Exon 1 CRISPR pair 2 For. |
EMBL Accession number: | - |
Latest sequence update: | 23/03/2017 |
Sequence detail: | Sequence of the human MALT1 CRISPR guide RNA: GCTCCTGGATCAGGCGCCCGA |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | The plasmid was deposited by Prof. Dr R. Beyaert(1)(2). It was constructed by Dr. N. Harper(3). (1) Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium (3) Institute of Translational Medicine, University of Liverpool, Liverpool, United Kingdom |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pX335-hMALT1-Exon1-CRISPR-2For (LMBP 9453) is available at BCCM/GeneCorner. The plasmid was deposited by Prof. Dr R. Beyaert. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.