Last data update: 24 January 2024 16:39 CET
Plasmid name: pdCDNA-Flag-hCARD9-R70W-L213LI (LMBP 10265)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | not available |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human caspase recruitment domain family member 9 cDNA (CARD9, GeneID 64170); mutated sequence FLAG epitope tag; N-terminal |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer Phage SP6 promoter Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pdcDNA-FLAG-hCARD9-L213LI |
| Further information: | The plasmid was created by introducing an R70W mutation into the human CARD9 coding sequence of the pdcDNA-FLAG-hCARD9-L213LI vector. The L213LI mutation, modelled on the oncogenic CARD11 L225LI mutation, increases the activity of CARD9 by more than eight times. The R70W mutation is associated with immunodeficiency. The nucleotide sequence of the wild type human CARD9 coding sequence corresponds with the EMBL Nucleotide Sequence Database accession number AF311287.1. |
| EMBL Accession number: | AF311287.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 20/04/2020 |
| Sequence detail: | Primers used to introduce the R70W mutation: Forward : tggacatcctgcagtggaccggccacaag Reverse : cttgtggccggtccactgcaggatgtcca |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Alves de Medeiros et al., J. Clin. Immunol. 36 (2016), 204-209 [PMID: 26961233] [DOI: 10.1007/s10875-016-0255-8] Lanternier et al., J. Allergy Clin. Immunol. 135 (2015), 1558-1568 [PMID: 25702837] [DOI: 10.1016/j.jaci.2014.12.1930] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pdCDNA-Flag-hCARD9-R70W-L213LI (LMBP 10265) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.