Last data update: 24 January 2024 16:39 CET
Plasmid name: YDp-H (LMBP 3353)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
ydp-h.gb
(View with Genome Compiler) ydp-h.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Saccharomyces cerevisiae histidine 3 disruption cassette (HIS3) |
| Promoter: | Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) HIS3; auxotrophic |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli Saccharomyces cerevisiae; his3(-), integrative |
| Parental clone: | pUC9HStop; pJH-H1 |
| Further information: | The plasmid was constructed by inserting a 1150 bp HaeII (blunted with T4 DNA polymerase) - XhoI (filled in with Klenow DNA polymerase) fragment of pJH-H1, containing the S. cerevisiae HIS3 auxotrophically selectable marker gene, into the unique HindIII site (filled in with Klenow DNA polymerase) of pUC9HStop, a pUC9 derivative differing in the sequence of the multicloning site. This is an integrative yeast plasmid designed for gene disruption purposes. The disruption cassette consists of the HIS3 gene, flanked by termination codons in all three reading frames and restriction sites. The termination codons prevent read-through from the remaining sequences of disrupted genes and those of the selectable disrupting fragment; in this way, possible artefactual phenotypic effects caused by fortuitous hybrid proteins are avoided. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequences at the junctions were experimentally verified by Dr G. Berben prior to deposit at BCCM/GeneCorner. |
| EMBL Accession number: | - |
| Latest sequence update: | 12/10/1995 |
| Sequence detail: | Nucleotide sequence at the termination modules flanking the HIS3 insert:
HindIII/HaeII fusion
stop module |
----------> |--> HIS3 DNA
5' GAATTCCCGGGGATCCGGTGATTGATTGAGCAAGCT|TAGGAGTC ...
EcoRI BamHI --- --- --- HindIII
ApoI SmaI
AvaI
XhoI/HindIII fusion
| stop module
--> HIS3 DNA| <----------
... GAACTCGA|AGCTTGCTCAATCAATCACCGGATCCGTCGACCTGCAGCCAAGCTAGCTT 3'
HindIII --- --- --- BamHI SalI PstI NheI
HindII
BspMI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: EcoRI/PstI, HaeII/XhoI, HindIII/XmnI and SmaI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr G. Berben(1). (1) Centre de Recherches agronomiques de l' Etat, Station de Chimie et de Physique agricoles, Laboratoire de Microbiologie, Gembloux, Belgium |
| Plasmid reference: | Berben et al., Yeast 7 (1991), 475-477 [PMID: 1897313] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12xB HB101 |
| Host reference: | Boyer and Roulland-Dussoix, J. Mol. Biol. 41 (1969), 459-472 [PMID: 4896022] |
| Related host reference: | Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Sambrook et al. (eds), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY (1989) [ISSN/ISBN: 0879693096] |
| Cultivation medium: | LB-Lennox + ampicillin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | Cultivation conditions: preferably under rotational shaking. |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
YDp-H (LMBP 3353) is available at BCCM/GeneCorner. This plasmid was deposited by Dr G. Berben and was published in Berben et al., 1991. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.