Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGS-E-mABIN-2 (LMBP 4370)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4370.gb
(View with Genome Compiler) p4370.txt p4370.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse A20-binding inhibitor of NF-κB activation 2 cDNA (ABIN-2, TNIP2) E-tag; N-terminal |
| Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pCAGGS |
| Further information: | Full-length mABIN-2 cDNA was constructed by assembling a 5' RACE fragment and the EST clone AA105249 by fusion PCR. The plasmid was constructed by inserting the XhoI-BglII cut PCR amplicon, containing the mABIN-2 coding sequence fused to an N-terminal E-tag, in the XhoI-BglII opened pCAGGS vector. pCAGGS-E-mABIN-2 is useful for highly efficient expression of mABIN-2 under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727201.1. The nucleotide sequence of the mABIN-2 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AJ304865.1. |
| EMBL Accession number: | AJ304865.1, view at EMBL, GenBank, DDBJ LT727201.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 06/06/2001 |
| Sequence detail: | Primers used for amplification of the 5' RACE fragment:
Forward primer: 5' TTGGAGACGCCCAAGTCCCCACGG 3'
Reverse primer: 5' GCAAGACTACCTCCTTCTCTTGC 3'
Primers used for amplification of the EST clone:
Forward primer: 5' AGAGAAGGAGGTAGTCTTGCTTCG 3'
Reverse primer: 5' GTCCTTGATGTACCAAGTGTGCC 3'
Primers used for fusion PCR of both fragments:
Forward primer:
5'CCGCTCGAGATGGGTGCGCCGGTGCCGTATCCGGATCCGCTGGAACCGCGTGAATTCGGGATCCGTATGTCGTCTGGGGACCCAAGG 3'
XhoI --------------------------------------- ***
E-tag
Reverse primer:
5'GGAGATCTTCATTGGCAGCACTCAGACAG 3'
BglII +++
***: start codon of the mABIN-2 gene.
+++: termination codon of the mABIN-2 gene. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglII/XhoI, StyI and XhoI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Van Huffel et al., J. Biol. Chem. 276 (2001), 30216-30223 [PMID: 11390377] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-mABIN-2 (LMBP 4370) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Van Huffel et al., 2001. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.