Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGS-F-mA20-R727A (LMBP 7787)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p7787.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse tumor necrosis factor, alpha-induced protein 3 cDNA (Tnfaip3, A20, Tnfip3, GeneID 21929); mutated sequence FLAG epitope tag; N-terminal |
| Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pCAGGS-FLAGmA20 |
| Further information: | The plasmid was constructed by introducing a R727A mutation into pCAGGS-FLAGmA20 via site-directed mutagenesis. A silent NheI restriction site was introduced via PCR, amplifying the parental vector from the NheI-location outwards, cutting the resulting fragment with BstXI/NheI and NheI/SalI and ligating both parts into the BstXI/XhoI opened pCAGGS-FLAGmA20 vector. A candidate site for the putative p75 cleavage site (described in Malinverni et al. (2010) and Wiesmann et al. (2012)) was mutated in mouse A20 via site-directed mutagenesis. The R727A substitution was made along with a silent NheI site for fast genotyping and cloning. Expression was confirmed by the depositor in HEK293T transfections. |
| EMBL Accession number: | - |
| Latest sequence update: | 11/07/2015 |
| Sequence detail: | Primers used to introduce the R727A mutation and the silent NheI site in mouse A20:
mA20-BstXI-F: 5' TCCAGCCTCACTTCCAGTATC
pCAGGS-R: 5' CCATAAGAGAAGAGGGACAGC
NheI-mA20-LACR/A-R: 5' CCTCGCTAGCACAGGCCAGAATGTTC
NheI
NheI-mA20-LACR/A-F: 5' CCTGTGCGCTAGCGAGGAACTCTGTATGG
NheI |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Inflammation Research Center, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Wiesmann et al., J. Mol. Biol. 419 (2012), 4-21 [PMID: 22366302] [DOI: 10.1016/j.jmb.2012.02.018] Malinverni et al., Biochem. Biophys. Res. Commun. 400 (2010), 543-547 [PMID: 20804738] [DOI: 10.1016/j.bbrc.2010.08.091] |
| Restricted distribution: | - VIB/BCCM MTA - Restricted to academic users |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-F-mA20-R727A (LMBP 7787) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.