Last data update: 24 January 2024 16:39 CET
Plasmid name: pCD-F-CFP-LVSRG-YFP (LMBP 6115)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p6115.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Aequorea victoria green fluorescent protein DNA (GFP); enhanced cyan fluorescent variant (ECFP) Aequorea victoria green fluorescent protein DNA (GFP); enhanced yellow-green fluorescent variant (EYFP) |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pdECFP; pdEYFP; pCD-F-MK-p20 |
| Further information: | The plasmid was constructed by PCR amplifying the CFP and YFP sequences from pdECFP and pdEYFP respectively, and ligating both coding sequences, fused via a MALT1 substrate linker, into the the KpnI/ApaI opened pCD-F-MK-p20 vector, replacing the human MALT1 fragment. When the construct is expressed, the protein is cleaved by MALT1, resulting in over 33% fluorescense resonance energy transfer from ECFP to EYFP. The parental clone of this vector has been shown to provide resistance to kanamycin, although growth was reduced compared to growth on medium containing ampicillin. |
| EMBL Accession number: | - |
| Latest sequence update: | 02/04/2009 |
| Sequence detail: | Primers used to amplify CFP cds:
KpnI-XFP-F: 5' ATGGTACCA.ATG.GTG.AGC.AAG.GGC.GAG.G
***
LVSRG-XFP-R: 5' CCCTCTCGAAACTAACTTGTACAGCTCGTCCATGC
Primers used to amplify YFP cds:
ApaI-XFP-R: 5' AAGGGGCCCCTTGTACAGCTCGTCCATGC
LVSRG-XFP-F: 5' TTAGTTTCGAGAGGGATGGTGAGCAAGGGCGAGG
XbaI-LVSRG-F: 5' CAATCTAGATTAGTTTCGAGAGGG
XbaI-LVSRG-R: 5' CAATCTAGACCCTCTCGAAACTAA
***: start codon. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCD-F-CFP-LVSRG-YFP (LMBP 6115) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.