Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF1-2FKBP-link-hFADD (LMBP 4610)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4610.gb
(View with Genome Compiler) p4610.txt p4610.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human Fas receptor-associated death domain cDNA (FADD) Human FK506-binding protein prolyl isomerase 1A cDNA (FKBP1A, FKBP-12, FKBP12C, PKC12, PPIASE, GeneID 2280) Rous sarcoma virus (RSV) tyrosine kinase gene (v-src); myristoylation-targeting sequence, N-terminal GSGGGS linker; N-terminal Influenza HA epitope encoding the haemagglutinin tagging peptide; C-terminal V5 epitope; C-terminal Histidine tag (His-tag); C-terminal |
| Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pEF1/V5-HisC; pCMF2E-link-hFADD |
| Further information: | The plasmid was constructed by inserting the 2047 bp EcoRI fragment of pCMF2E-link-hFADD, containing the hFADD coding sequence fused to the N-terminal v-src myristoylation-targeting sequence, the N-terminal tandem repeat of hFKBP1A, the N-terminal GSGGGS linker and the C-terminal HA epitope, in the EcoRI opened pEF1/V5-HisC vector. The C-terminal V5 epitope and histidine tag are not expressed. pEF1-2FKBP-link-hFADD is designed for high-level expression of the fusion protein under control of the hEF1α promoter in mammalian cells. hFKBP1A is a member of the immunophilin protein family, which plays a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. The fusion protein can be dimerized upon AP1510 (synthetic analogue of FK1012 ligand) administration. The v-src myristoylation-targeting sequence directs the fusion protein to cellular membranes. There is uncertainty about the presence of a second enhancer in the SV40 early promoter. The absence of a second enhancer in this promoter may cause bacterial leakage expression of the Tn5 neomycin resistance gene. This would cause transformed E. coli cells to be resistant to kanamycin, although growth should be reduced compared to growth on medium containing ampicillin. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727126.1. The nucleotide sequence of the hFADD cDNA corresponds with the EMBL Nucleotide Sequence Database accession number U24231.1. Other name of the plasmid is pEF1-V5HisC-2FKBP-link-hFADD. |
| EMBL Accession number: | U24231.1, view at EMBL, GenBank, DDBJ LT727126.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 26/01/2004 |
| Sequence detail: | Nucleotide sequence of the fusion gene:
------- v-src myristoylation-targeting sequence ------>
5' ... GGTGGAATTCGCGCGT.ATG.GGG.AGT.AGC.AAG.AGC.AAG.CCT.AAG.GAC.CCC.AGC.CAG.CGC.TCT.
EcoRI Met Gly Ser Ser Lys Ser Lys Pro Lys Asp Pro Ser Gln Arg Ser
*** XbaI
SalI|XhoI
------------- hFKBP1A ------------> | ------------- hFKBP1A ---------
AGA.GGA.GTG.CAG.GTG ... CTA.AAA.CTG.GAA.G|TC.GAG.GGC.GTG.CAG.GTG ... CTA.AAA.CTG.
Arg Gly Val Gln Val Leu Lys Leu Glu Val Glu Gly Val Gln Val Leu Lys Leu
SpeI|XbaI XbaI|SpeI
--> | ------- linker -------> | ----------------- hFADD -----------
GAA.A|CT.AGA.GGG.TCT.GGA.GGC.GGA.TCC.T|CT.AGT.ATG.GAC.CCG.TTC.CTG ... ACC.TCC.GAA.
Glu Thr Arg Gly Ser Gly Gly Gly Ser Ser Ser Met Asp Pro Phe Leu Thr Ser Glu
G S G G G S ***
BamHI
XbaI|SpeI
------> | ----------- HA epitope ----------->
GCG.TCC.T|CT.AGT.TAT.CCG.TAC.GAC.GTA.CCA.GAC.TAC.GCA.TAA.GAAAAGTGAGGATCCTGAGAACT
Ala Ser Ser Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala +++ BamHI
-------------
... TTTGGCAAAGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGGTCACCCATTCGAAGGTAAGCCTATCC
EcoRI EcoRV NotI XhoI BstEII Csp45I
PstI BstXI
-- V5 epitope --------------> ---- His-tag ---->
CTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGAGTTTAAACCCGCTG ... 3'
AgeI
***: start codon.
+++: termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AdeI, Alw44I/NdeI, BamHI/SalI, Eco81I, EcoRI and PdmI/PvuII. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by G. Van Loo(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Vanden Berghe et al., J. Biol. Chem. 279 (2004), 7925-7933 [PMID: 14668343] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF1-2FKBP-link-hFADD (LMBP 4610) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.