GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pEF1-2FKBP-link-hFADD-DN (LMBP 4611)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p4611.gb (View with Genome Compiler)
p4611.txt
p4611.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human Fas receptor-associated death domain cDNA (FADD); dominant negative part (DN)
Human FK506-binding protein prolyl isomerase 1A cDNA (FKBP1A, FKBP-12, FKBP12C, PKC12, PPIASE, GeneID 2280)
Rous sarcoma virus (RSV) tyrosine kinase gene (v-src); myristoylation-targeting sequence, N-terminal
GSGGGS linker; N-terminal
Influenza HA epitope encoding the haemagglutinin tagging peptide; C-terminal
V5 epitope; C-terminal
Histidine tag (His-tag); C-terminal
Promoter: Human elongation factor 1α promoter (EF1α)
Phage T7 gene 10 promoter (T7g10)
Simian virus 40 early promoter (SV40 early)
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Bovine growth hormone polyadenylation signal (BGH polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Neomycin (neo; G418)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pEF1/V5-HisC; pCMF2E-link-hFADD-DN
Further information: pEF1-2FKBP-link-hFADD-DN was constructed by inserting the 1810 bp EcoRI fragment of pCMF2E-link-hFADD-DN, containing the hFADD-DN coding sequence fused to the N-terminal v-src myristoylation-targeting sequence, the N-terminal tandem repeat of hFKBP1A, the N-terminal GSGGGS linker and the C-terminal HA epitope, in the EcoRI opened pEF1/V5-HisC vector. The C-terminal V5 epitope and histidine tag are not expressed.
The hFADD-DN insert encodes amino acid 80 to 208, containing the death domain (DD) defined from codon 101 to 179.
pEF1-2FKBP-link-hFADD-DN is designed for high-level expression of the fusion protein under control of the hEF1α promoter in mammalian cells.
hFKBP1A is a member of the immunophilin protein family, which plays a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin.
The fusion protein can be dimerized upon AP1510 (synthetic analogue of FK1012 ligand) administration.
The v-src myristoylation-targeting sequence directs the fusion protein to cellular membranes.
There is uncertainty about the presence of a second enhancer in the SV40 early promoter. The absence of a second enhancer in this promoter may cause bacterial leakage expression of the Tn5 neomycin resistance gene.
This would cause transformed E. coli cells to be resistant to kanamycin, although growth should be reduced compared to growth on medium containing ampicillin.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727127.1.
The nucleotide sequence of the hFADD cDNA corresponds with the EMBL Nucleotide Sequence Database accession number U24231.1.
Other name of the plasmid is pEF1-V5HisC-2FKBP-link-hFADD-DN.
EMBL Accession number: U24231.1, view at EMBL, GenBank, DDBJ
LT727127.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 26/01/2004
Sequence detail:
Nucleotide sequence of the fusion gene:

                        ------- v-src myristoylation-targeting sequence ------>   
5' ... GGTGGAATTCGCGCGT.ATG.GGG.AGT.AGC.AAG.AGC.AAG.CCT.AAG.GAC.CCC.AGC.CAG.CGC.TCT.
           EcoRI        Met Gly Ser Ser Lys Ser Lys Pro Lys Asp Pro Ser Gln Arg Ser 
                        ***                                                     XbaI 
                                         SalI|XhoI                                   
        ------------- hFKBP1A ------------>  |       ------------- hFKBP1A --------- 
    AGA.GGA.GTG.CAG.GTG ... CTA.AAA.CTG.GAA.G|TC.GAG.GGC.GTG.CAG.GTG ... CTA.AAA.CTG.
    Arg Gly Val Gln Val     Leu Lys Leu Glu Val  Glu Gly Val Gln Val     Leu Lys Leu  

                                                  ------------- hFADD fragment ------
     SpeI|XbaI                        XbaI|SpeI               -- death domain -->
    -->  |       ------- linker ------->  |        80  81     101 102     178 179
    GAA.A|CT.AGA.GGG.TCT.GGA.GGC.GGA.TCC.T|CT.AGT.GAC.GAC ... TTT.AAC ... CAA.GAG ...
    Glu Thr  Arg Gly Ser Gly Gly Gly Ser Ser  Ser Asp Asp     Phe Asn     Gln Glu   
                  G   S   G   G   G   S           
                                 BamHI  
         XbaI|SpeI
    ------>  | 
    207 208  |       ----------- HA epitope ----------->
    GCG.TCC.T|CT.AGT.TAT.CCG.TAC.GAC.GTA.CCA.GAC.TAC.GCA.TAA.GAAAAGTGAGGATCCTGAGAACT
    Ala Ser Ser  Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala +++          BamHI    

                                                                      -------------
    ... TTTGGCAAAGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGGTCACCCATTCGAAGGTAAGCCTATCC
                 EcoRI     EcoRV           NotI   XhoI BstEII   Csp45I
                      PstI      BstXI

    -- V5 epitope -------------->         ---- His-tag ---->
    CTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGAGTTTAAACCCGCTG ... 3'
                                    AgeI
***: start codon.
+++: termination codon.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: AdeI, Alw44I/NdeI, BamHI/SalI, Eco81I, EcoRI and PdmI/PvuII.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by G. Van Loo(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Vanden Berghe et al., J. Biol. Chem. 279 (2004), 7925-7933 [PMID: 14668343]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pEF1-2FKBP-link-hFADD-DN (LMBP 4611) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search