Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF1-AVPS-hOMI-S306A (LMBP 4583)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4583.gb
(View with Genome Compiler) p4583.txt p4583.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human serine protease cDNA (OMI, HTRA2); mutated mature sequence V5 epitope; C-terminal Histidine tag (His-tag); C-terminal |
| Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pEF1/V5-HisA |
| Further information: | The plasmid was constructed by inserting a KpnI-XbaI PCR fragment, amplified from a HepG2 cDNA library and containing the mutated hOMI mature sequence, between the KpnI and XbaI sites of pEF1/V5-HisA. Because of the presence of the hOMI termination codon, the C-terminal V5 epitope and histidine tag are not expressed. The hOMI insert does not include a mitochondrial targeting sequence. The first four amino acids of the mature human Omi/HtrA2 protein are alanine, valine, proline and serine (AVPS). The serine (S) codon at position 306 of the full-length hOMI coding sequence was replaced by an alanine (A) codon, creating an additional NaeI site. The human Omi/HtrA2 serine point mutant is no longer cytotoxic. pEF1-AVPS-hOMI-S306A is designed for high-level expression of mutated mature hOMI in mammalian cells. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. There is uncertainty about the presence of a second enhancer in the SV40 early promoter. The absence of a second enhancer in this promoter may cause bacterial leakage expression of the Tn5 neomycin resistance gene. This would cause transformed E. coli cells to be resistant to kanamycin, although growth should be reduced compared to growth on medium containing ampicillin. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727112.1. The nucleotide sequence of the wild-type hOMI cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AF141305.1. Other name of the plasmid is pEF1-AVPS-hOmi/HtrA2-S306A. |
| EMBL Accession number: | AF141305.1, view at EMBL, GenBank, DDBJ LT727112.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 21/01/2004 |
| Sequence detail: | Nucleotide sequence of the mutated hOMI mature sequence:
------------------------------------------------- hOMIm
134 306
5' ... GGTAAGCTTGGTACC.ATG.GCC.GTC.CCT.AGC.CCG ... GGA.AAC.GCC.GGC.GGT ... CCT
HindIII Met Ala Val Pro Ser Pro Gly Asn Ala Gly Gly Pro
KpnI *** A V P S NaeI
NcoI ^ ^ ^
StyI
hOMIm ------------>
458 --------------- V5 epitope ------
GAG.GTC.ACA.GAA.TGA.TCTAGAGGGCCCTTCGAAGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTC
Glu Val Thr Glu +++ XbaI ApaI AsuII
--------> ---- His-tag ---->
GATTCTACGCGTACCGGTCATCATCACCATCACCATTGA ... 3'
AgeI
***: Start codon.
+++: Termination codon.
^ : Mutated nucleotide.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: EcoRI/PstI, HindII, KpnI, NaeI, SspI and XmnI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by G. Van Loo(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Vande Walle et al., J. Proteome Res. 6 (2007), 1006-1015 [PMID: 17266347] |
| Related plasmid reference: | Suzuki et al., Mol. Cell 8 (2001), 613-621 [PMID: 11583623] Van Loo et al., Cell Death Differ. 9 (2002), 20-26 [PMID: 11803371] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF1-AVPS-hOMI-S306A (LMBP 4583) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele and was published in Vande Walle et al., 2007. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.