Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF1-hOMI (LMBP 4580)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4580.gb
(View with Genome Compiler) p4580.txt p4580.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human serine protease cDNA (OMI, HTRA2) V5 epitope; C-terminal Histidine tag (His-tag); C-terminal |
| Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pEF1/V5-HisA |
| Further information: | The plasmid was constructed by inserting a KpnI-XbaI PCR fragment, amplified from a HepG2 cDNA library and containing the full-length hOMI coding sequence, between the KpnI and XbaI sites of pEF1/V5-HisA. Because of the presence of the hOMI termination codon, the C-terminal V5 epitope and histidine tag are not expressed. The full-length hOMI coding sequence includes an N-terminal mitochondrial targeting sequence. pEF1-hOMI is designed for high-level expression of hOMI in mammalian cells. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. There is uncertainty about the presence of a second enhancer in the SV40 early promoter. The absence of a second enhancer in this promoter may cause bacterial leakage expression of the Tn5 neomycin resistance gene. This would cause transformed E. coli cells to be resistant to kanamycin, although growth should be reduced compared to growth on medium containing ampicillin. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727109.1. The nucleotide sequence of the hOMI cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AF141305.1. Other name of the plasmid is pEF1-hOmi/HtrA2. |
| EMBL Accession number: | AF141305.1, view at EMBL, GenBank, DDBJ LT727109.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 21/01/2004 |
| Sequence detail: | Primers used to amplify hOMI:
Forward primer: 5' GGGGTACCATGGCTGCGCCGAGGGCG 3'
KpnI
Reverse primer: 5' GCTCTAGATCATTCTGTGACCTCAGGGGTC 3'
XbaI
Nucleotide sequence of the hOMI coding sequence:
-------------------------------------------------- hOMI
1 134
5' ... GGTAAGCTTGGTACC.ATG.GCT.GCG.CCG.AGG.GCG ... GCC.GCC.GTC.CCT.AGC.CCG ...
HindIII Met Ala Ala Pro Arg Ala Ala Ala Val Pro Ser Pro
KpnI *** A V P S
NcoI
StyI
hOMI ----------------------------------------->
306 458 -----
GGA.AAC.TCT.GGA.GGT ... CCT.GAG.GTC.ACA.GAA.TGA.TCTAGAGGGCCCTTCGAAGGTAA
Gly Asn Ser Gly Gly Pro Glu Val Thr Glu +++ XbaI ApaI AsuII
---------- V5 epitope --------------> ---- His-tag ---->
GCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGA ... 3'
AgeI
***: Start codon.
+++: Termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: EcoRI/PstI, HindII, KpnI, NaeI, SspI and XmnI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by G. Van Loo(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Suzuki et al., Mol. Cell 8 (2001), 613-621 [PMID: 11583623] Vande Walle et al., J. Proteome Res. 6 (2007), 1006-1015 [PMID: 17266347] Van Loo et al., Cell Death Differ. 9 (2002), 20-26 [PMID: 11803371] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF1-hOMI (LMBP 4580) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.