Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF1-mRIP1-DD-V5-His (LMBP 4829)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p4829.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse receptor TNFRSF-interacting serine-threonine kinase 1 cDNA (Ripk1, Rip1, Rinp, GeneID 19766); death domain (Ripk1-DD) V5 epitope; C-terminal Histidine tag (His-tag); C-terminal |
Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pEF1-mRIP-V5/His |
Further information: | The plasmid was constructed by inserting a 321 bp BamHI-XbaI fragment, containing the death domain (DD, amino acids 553-656) of the mouse Ripk1 cDNA, between the BamHI and the XbaI site of pEF1-mRIP-V5/His. As a result, mouse Ripk1-DD was fused in phase to the C-terminal V5 epitope and histidine tag. pEF1-mRIP1-DD-V5-His is designed for high-level expression of mouse Ripk1-DD under control of the human EF1α promoter in mammalian cells. There is uncertainty about the presence of a second enhancer in the SV40 early promoter. The absence of a second enhancer in this promoter may cause bacterial leakage expression of the Tn5 neomycin resistance gene. This would cause transformed E. coli cells to be resistant to kanamycin, although growth should be reduced compared to growth on medium containing ampicillin. The nucleotide sequence of the mouse Ripk1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number BC058162.1. Other names of the plasmid are pEF1-mRIP1-DD-His/V5 and pEF1-mRIP-DD-V5/His. |
EMBL Accession number: | BC058162.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 24/02/2005 |
Sequence detail: | Nucleotide sequence of the fusion gene: -- T7 promoter -> 5' ... TAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGGTAAGCTTGGTACCGAGCTCGGATCC HindIII SacI BamHI KpnI ---------------- mRIP1-DD ----------------> 553 656 ATG.TCG.ACT.TCC.AGA.CAC ... CGT.GCC.AGC.CAG.AGC.TCT.AGA.GGG.CCC Met Ser Thr Ser Arg His Arg Ala Ser Gln Ser Ser Arg Gly Pro *** SacI XbaI ApaI HindII SalI --------------------- V5 epitope ---------------------> TTC.GAA.GGT.AAG.CCT.ATC.CCT.AAC.CCT.CTC.CTC.GGT.CTC.GAT.TCT.ACG Phe Glu Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr ------- His-tag ------> CGT.ACC.GGT.CAT.CAT.CAC.CAT.CAC.CAT.TGA.GTTTAAACCCGCTGATC ... 3' Arg Thr Gly His His His His His His +++ AgeI ***: Start codon. +++: Termination codon. Punctuation indicates reading frame. |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1)(2). It was constructed by Dr T. Vanden Berghe(1) (2). (1) VIB-UGent Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF1-mRIP1-DD-V5-His (LMBP 4829) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.