Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF6-F-GFP-S65T-DEVDG-QP-IRES-DsRed (LMBP 7430)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p7430.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Aequorea victoria green fluorescent protein DNA (GFP); enhanced red-shifted variant (EGFP); mutated sequence Discosoma sp. red fluorescent protein DNA (DsRed1); variant (DsRed-Express2) |
| Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Synthetic prokaryotic EM7 promoter Escherichia coli lac operon promoter |
| Ribosome binding site: |
Internal ribosome entry site (IRES) of the encephalomyocarditis virus (EMCV) polyprotein gene |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Blasticidin (bsd) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli; preferably recombination-deficient and endonuclease A deficient strains Mammalian cells; SV40 permissive cells |
| Parental clone: | pEF6-F-GFP-S65T-LVSRG-QP-IRES-DsRed |
| Further information: | The plasmid was constructed via BamHI/MluI and MluI/EcoRI restriction digest on pEF6-F-GFP-S65T-LVSRG-QP-IRES-DsRed, resulting in a 5669bp and 1398bp fragment respectively. Next, a caspase cleavage site was introduced between the GFP and M2-derived quenching peptide using double PCR on a MALT1 probe template. The resulting EcoRI/NheI and NheI/BamHI fragments were combined with the first two fragments in a single ligation reaction. The plasmid encodes for a caspase-activated GFP mutant, containing an S65T mutation. |
| EMBL Accession number: | - |
| Latest sequence update: | 30/07/2019 |
| Sequence detail: | Primers used to PCR amplify the fragments to introduce a caspase cleavage site: Left product: Forward: 5' TAATACGACTCACTATAGGG Reverse: 5' GGGGCTAGCCCCATCTACTTCATCTTTGTATAGTTCATCCATGCC Right product Forward: 5' GGGGCTAGCGATGAAGTAGATGGGTGCAACGATTCAAGTGACCC Reverse: 5' TCCAACTCACAACGTGGCACT |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF6-F-GFP-S65T-DEVDG-QP-IRES-DsRed (LMBP 7430) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.