Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF6-His-PKR-ND1-228 (LMBP 4847)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p4847.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human eukaryotic translation initiation factor 2 alpha kinase 2 cDNA (EIF2AK2, PRKR, PKR, PPP1R83, GeneID 5610); N-terminal domain (PKR-ND) Histidine tag (His-tag); N-terminal Thrombin recognition site; N-terminal |
| Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Synthetic prokaryotic EM7 promoter Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Blasticidin (bsd) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli; preferably recombination-deficient and endonuclease A deficient strains Mammalian cells; SV40 permissive cells |
| Parental clone: | pEF6/Myc-HisA |
| Further information: | PCR on pET15b-His6-hPKR with a T7 promotor primer and a primer adding a stop after 11128 + a NotI site (TTTTTTTGCGGCCGCTCACAAAGATCTTTTTGCCTTCC). Cleavage with XbaI then PNK + KL treatment to blunt, ligation with Bst XI/EcoRI adapter and ligation into pCDM8 at the BSTXI. Cleavage of pCDM8-His6-hPKR-ND 1-228 with XbaI and ligation of insert into pEF6A opened at XbaI. The nucleotide sequence of the human PKR coding sequence corresponds with the EMBL Nucleotide Sequence database accession number M35663.1. |
| EMBL Accession number: | M35663.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 29/01/2007 |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by Dr M. Kalai(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Kalai et al., Cell Death Differ. 14 (2007), 1050-1059 [PMID: 17318221] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF6-His-PKR-ND1-228 (LMBP 4847) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele and was published in Kalai et al., 2007. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.