Last data update: 24 January 2024 16:39 CET
Plasmid name: pENT-miR125a (LMBP 9051)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p9051.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse microRNA 125a (Mir125a, Mirn125a, mmu-mir-125a) |
| Promoter: | Phage T7 gene 10 promoter (T7g10) |
| Ribosome binding site: |
- |
| Terminator: | Escherichia coli rrnB operon T1 terminator Escherichia coli rrnB operon T2 terminator |
| Selection marker: | Neomycin (neo; kanamycin (kan)) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pENTR1A |
| Further information: | The plasmid was constructed by cloning the 68 bp mmu-mir-125a in the pENTR1A vector. |
| EMBL Accession number: | - |
| Latest sequence update: | 31/03/2014 |
| Sequence detail: | Nucleotide sequence of the miR125a: 5' CTGGGTCCCTGAGACCCTTTAACCTGTGAGGACGTCCAGGGTCACAGGTGAGGTTCTTGGGAGCCTGG |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr M. Farhang(1) (2) and Prof. Dr G. Van Loo(1) (2). (1) Inflammation Research Center, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + kanamycin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pENT-miR125a (LMBP 9051) is available at BCCM/GeneCorner. This plasmid was deposited by Dr M. Farhang and Prof. Dr G. Van Loo . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.