Last data update: 24 January 2024 16:39 CET
Plasmid name: pENTR-R2L3-mKate (LMBP 9007)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p9007.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Entacmaea quadricolor red fluorescent protein DNA (eqFP578, RFP); bright monomeric far-red fluorescent variant (TagFP635, mKate) |
Promoter: | - |
Ribosome binding site: |
- |
Terminator: | - |
Selection marker: | Streptomycin (Sm; spectinomycin (Sp)) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli |
Parental clone: | pDONR-C-attP2rP3; pEF6-mKate2-MCS |
Further information: | This Gateway entry vector was constructed by Gateway B/P reaction between pDONR-C-attP2rP3 and the PCR-amplified mKate from pEF6-mKate2-MCS, with attB2r and attB3-sites added to the forward and reverse primer respectively. |
EMBL Accession number: | - |
Latest sequence update: | 28/02/2014 |
Sequence detail: | Primers used to amplify mKate: <-- attB2r -->| <-- mKATE Forward: 5' GGGGACAGCTTTCTTGTACAAAGTGGC|C.ATG.GTG.AGC.GAG.CTG.ATT.AA <-- attB3 --> <-- mKATE Reverse: 5' GGGGACAACTTTGTATAATAAAGTT|GTTTA.TCT.GTG.CCC.CAG.TTT.GCT.AG Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AvaI and NotI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr M. De Ceuleneer(1) and Prof. Dr R. Beyaert(1). (1) BCCM/GeneCorner, Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + spectinomycin (150 μg/ml) |
Cultivation temperature: | 28°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pENTR-R2L3-mKate (LMBP 9007) is available at BCCM/GeneCorner. This plasmid was deposited by Dr M. De Ceuleneer and Prof. Dr R. Beyaert. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.