Last data update: 24 January 2024 16:39 CET
Plasmid name: pENTR3C-NvCARD-CC-L217LI (LMBP 10176)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | not available |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Nematostella vectensis caspase recruitment domain homolog cDNA (CARD-CC); mutated sequence |
| Promoter: | - |
| Ribosome binding site: |
- |
| Terminator: | Escherichia coli rrnB operon T1 terminator Escherichia coli rrnB operon T2 terminator |
| Selection marker: | Neomycin (neo; kanamycin (kan)) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pENTR3C-NvCARD-CC |
| Further information: | This Gateway entry plasmid was constructed by introducing an L217LI mutation into the N. vectensis CARD-CC coding sequence of pENTR3C-NvCARD-CC. The L/LI mutation corresponds to the oncogenic L225LI mutation in human CARD11. N. vectensis CARD-CC is usually poorly active upon overexpression. This construct is made to study activated CARD-CC. |
| EMBL Accession number: | - |
| Latest sequence update: | 28/10/2019 |
| Sequence detail: | Primers to introduce the L217LI mutation: Forward: 5' TTAATTCAAATGAAATTGCTGACAG Reverse: 5' CGCGATAATAAATGTATTCCTCT |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2) and Dr J. Staal(1) (2). (1) Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + kanamycin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pENTR3C-NvCARD-CC-L217LI (LMBP 10176) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and Dr J. Staal . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.