GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pENTR3C-NvPCASP-t1A (LMBP 9875)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p9875.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Nematostella vectensis type 1 paracaspase cDNA (PCASP-t1A, MALT1 homolog)
Promoter: -
Ribosome
binding site:
-
Terminator: Escherichia coli rrnB operon T1 terminator
Escherichia coli rrnB operon T2 terminator
Selection marker: Neomycin (neo; kanamycin (kan))
Replicon: Escherichia coli plasmid pMB1 origin
Host range: -
Parental clone: pENTR3C; pCDNA3.1-Flag-HLH-NvPCASPt1A
Further information: The plasmid was constructed by PCR amplifying the N. vectensis PCASPt1A coding sequence from pCDNA3.1-Flag-HLH-NvPCASPt1A and cloning it into the HincII/XhoI opened pENTR3C vector.
EMBL Accession number: -
Latest sequence update: 30/07/2019
Sequence detail:
Primers used to amplify the N. vectensis PCASPt1A CDS:

Forward: 5' CATGCGCATGGGTGGTAGCCCTAC

Reverse: 5' ATATCTCGAGTTAGCAAAATGCCATAG
                XhoI
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Staal et al., bioRxiv (2016), 1-42 [DOI: 10.1101/046789]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + kanamycin (50 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pENTR3C-NvPCASP-t1A (LMBP 9875) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert and was published in Staal et al., 2016.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search