GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pET-11a (LMBP 2290)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p2290.gb (View with Genome Compiler)
p2290.txt
p2290.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Phage T7 gene 10 (T7g10); first 11 codons
Escherichia coli lac repressor gene (lacI)
Promoter: Phage T7 gene 10 promoter (T7g10) with lac operator (T7lac)
Escherichia coli lac repressor promoter (lacI)
Ribosome
binding site:
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10)
Terminator: Phage T7 gene 10 terminator (T7g10)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Parental clone: pET-10a; pAR4369
Further information: pET-11a is an expression vector useful to maintain and express genes that are toxic to E. coli.
The plasmid contains the T7lac promoter, existing of a 25 bp lac operator sequence immediately downstream from the 17 bp T7 promoter. Binding of the lac repressor at this site effectively reduces transcription by T7 RNA polymerase.
The plasmid also carries its own copy of the E. coli lac repressor gene (lacI).
The first 11 T7g10 codons are also present and the subsequent BamHI expression site generates a GGA codon in the reading frame. Other reading frames are available in pET-11b and pET-11c.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727489.1.
EMBL Accession number: LT727489.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 26/04/2004
Sequence detail:
Nucleotide sequence following the T7lac promoter:

            -- T7 promoter ->    --- lac operator --->
5' ... GAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTT
                                                          XbaI

                        --------------- T7 gene 10 --------------->
                         1               5                   10  11  
AACTTTAAGAAGGAGATATACAT.ATG.GCT.AGC.ATG.ACT.GGT.GGA.CAG.CAA.ATG.GGT.CGC.GGA.TCC ... 3'
         --SD--         *** NheI                                        BamHI
                    NdeI

***: start codon.
SD : Shine-Dalgarno sequence.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BamHI and RsaI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr W. Studier(1).
(1) Brookhaven National Laboratory, Upton, New York, USA
Plasmid reference: Dubendorff et al., J. Mol. Biol. 219 (1991), 45-59 [PMID: 1902522]
Related plasmid reference: Studier et al., Methods Enzymol. 185 (1990), 60-89 [PMID: 2199796]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pET-11a (LMBP 2290) is available at BCCM/GeneCorner. This plasmid was deposited by Dr W. Studier and was published in Dubendorff et al., 1991.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search