Last data update: 24 January 2024 16:39 CET
Plasmid name: pFA6a-KAN-SpcnxP (LMBP 5069)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p5069.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Schizosaccharomyces pombe calnexin cDNA (Spcnx); fragment (AA 448-560) |
| Promoter: | Eremothecium gossypii translation elongation factor 1α promoter (TEF1α) Schizosaccharomyces pombe calnexin promoter (Spcnx) Phage SP6 promoter Phage T7 gene 10 promoter (T7g10) |
| Ribosome binding site: |
- |
| Terminator: | Eremothecium gossypii translation elongation factor 1α terminator (TEF1α) Pichia pastoris alcohol oxidase 1 terminator (AOX1) Schizosaccharomyces pombe calnexin terminator (Spcnx) |
| Selection marker: | Ampicillin (amp) Kanamycin (kan, G418) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli Schizosaccharomyces pombe; integrative |
| Parental clone: | pFA6a-KAN-Sp3'; pFA6a-GFP(S65T)-kanMX6 |
| Further information: | Plasmid pFA6a-GFP(S65T)-kanMX6 was opened using SacI and SacII for the insertion of a SacI/SacII digested PCR fragment consisting of the 532 bps, flanking the calnexin gene of S. pombe. The resulting plasmid was called pFA6a-KAN-Sp3'. This plasmid was cut with BamHI and AscI to remove the GFP(S65T) ORF and ligated to a BamHI/AscI treated PCR fragment containing the S. pombe cnx promoter region. For easier downstream cloning events a unique ApaI and EcoRI site were integrated into the antisense primer. The vector obtained after ligation was called pFA6a-KAN-SpcnxP. The nucleotide sequence of the Spcnx gene was obtained from Genbank (Accession number U13389.1. Other name of the plasmid is pFA6a-KAN-Sp3'/5'. |
| EMBL Accession number: | U13389.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 19/09/2005 |
| Sequence detail: | Primers used to amplify calnexin cds from gDNA:
Forward: 5' TCCGAGCTCGAGTCTAATCAAATTCTTGAGAAG
SacI
Revese: 5' TCCCCGCGGAGTCGCTACTTTGAGTCAAAC
SacII
Primers used to amplify the S. pombe cnx promoter region:
Forward: 5' CGCGGATCCTTGATACCTACAGTTGTTATGC
BamHI
Reverse: 5' TTGGCGCGCCGGGCCCATCGGAATTCGATAACTACGGTGCGCGG
AscI |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr N. Callewaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) + kanamycin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pFA6a-KAN-SpcnxP (LMBP 5069) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr N. Callewaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.