Last data update: 24 January 2024 16:39 CET
Plasmid name: pGEMgcTNF2 (LMBP 2546)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p2546.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Canine tumor necrosis factor genomic DNA (cTNF) |
| Promoter: | Phage SP6 promoter Phage T7 gene 10 promoter (T7g10) |
| Ribosome binding site: |
- |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pGEMgcTNF2 |
| Further information: | The plasmid was presumably constructed as follows: genomic DNA containing canine TNF was ligated as a BamHI-EcoRI fragment into the BamHI-BglI and BglI-EcoRI fragments of pGEM1. Only the coding sequence of canine TNF is known; the sequence of the introns is unknown. Restriction sites on the plot were experimentally verified. Other name of the plasmid is pgCTNF182. |
| EMBL Accession number: | - |
| Latest sequence update: | 01/10/1995 |
| Sequence detail: | Nucleotide sequence between the T7 and SP6 promoters:
5' GAATACAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCCGGGCGAGCTCGAATTCCGGTC
* HindIII PstI SalI XbaI BamHI SacI EcoRI
AccI SmaI
HindII XmaI
BspMI AvaI
TCCC 3'
+
* : Start mRNA from SP6 promoter
+ : Start mRNA from T7 promoter |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by F. Duerinck(1) (2) and Prof. Dr W. Fiers(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061(λ) |
| Host reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
| Related host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pGEMgcTNF2 (LMBP 2546) is available at BCCM/GeneCorner. This plasmid was deposited by F. Duerinck and Prof. Dr W. Fiers . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.