Last data update: 24 January 2024 16:39 CET
Plasmid name: pGL3casp11p-Del2 (LMBP 5182)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5182.gb
(View with Genome Compiler) p5182.txt p5182.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+)) |
Promoter: | Mouse cysteinyl aspartate specific proteinase 11 promoter (CASP-11); 180 bp fragment (CASP-11p-Del2) |
Ribosome binding site: |
- |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) Synthetic polyadenylation signal (polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
Host range: | Escherichia coli Mammalian cells |
Parental clone: | pGL3casp11p; pGL3-Basic |
Further information: | The plasmid was constructed as follows: 1) the 180 bp mouse caspase-11 promoter fragment (mCASP-11p-Del2) + the first 25 nucleotides of the mouse caspase-11 mRNA were generated by PCR using pGL3casp11p as template; 2) the amplified DNA fragment was unidirectionally cloned between the MluI and NcoI sites of the pGL3-Basic vector. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726952.1. The nucleotide sequence of the mouse caspase-11 promoter fragment corresponds with the EMBL Nucleotide Sequence Database accession number AF539416.1. Other name of the plasmid is pGL3-casp11p-Del2. |
EMBL Accession number: | AF539416.1, view at EMBL, GenBank, DDBJ LT726952.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 06/03/2007 |
Sequence detail: | Primers used to amplify the 180 bp promoter fragment and 25 bp mRNA fragment of mCASP-11: Fwd : 5' CGACGCGTTGTTTGTTCCCATGACGAAGTGA 3' MluI Rev : 5' CATGCCATGGCCTCAGTTCTTTCGCACTGTGAAGA 3' NcoI |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: KpnI, MluI/NcoI and TatI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). It was constructed by Dr R. Schauvliege(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Schauvliege et al., J. Biol. Chem. 277 (2002), 41624-41630 [PMID: 12198138] |
Related plasmid reference: | Sherf et al., Promega Notes Magazine 49 (1994), 14-21 |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pGL3casp11p-Del2 (LMBP 5182) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Schauvliege et al., 2002. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.