GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pICOb (LMBP 9607)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p9607.gb (View with Genome Compiler)
p9607.txt
p9607.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: -
Promoter: Escherichia coli β-lactamase promoter (amp)
Ribosome
binding site:
Ribosome binding site (RBS) of the Escherichia coli ampicillin resistance gene (amp)
Terminator: -
Selection marker: Blasticidin (bsd)
Replicon: Escherichia coli plasmid pMB1 origin; truncated
Host range: Escherichia coli
Parental clone: pUCmu
Further information: The plasmid was constructed by PCR amplifying the pUCmu vector backbone without the coding sequence of the ampicillin resistance gene, and PCR amplifying the coding sequence of the blasticidin resistance gene. The two PCR fragments were subsequently fused with CloneEZ, effectively replacing the ampicillin resistance of pUCmu with blasticidin resistance.
pICOb is a minimal cloning plasmid with an extended multiple cloning site.
EMBL Accession number: -
Latest sequence update: 28/02/2018
Sequence detail:
Sequence at the multiple cloning site:

...ACGCGTCGCGAGGCCATATGGGTTAACCCATGGCCAAGCTTGCATGCCTGC
   MluI          NdeI   HpaI  NcoI    HindIII     PstI

AGGTCGACTCTAGAGGATCCCGGGTACCGAGCTCGAATTCGGATATCCTCGAG
  SalI  XbaI  BamHI   KpnI  SacI  EcoRI  EcoRV XhoI
                  XmaI RsaI

ACTAGTGGGCCCGTTTAAAC...
SpeI  ApaI  PmeI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: HindIII, PvuII/SpeI, PvuII/XhoI and RsaI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr J. Staal(1) (2) and Prof. R. Beyaert(1) (2).
(1) VIB-UGent Center for Inflammation Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + blasticidin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pICOb (LMBP 9607) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search