Last data update: 24 January 2024 16:39 CET
Plasmid name: pPCV (LMBP 9004)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p9004.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Saccharomyces cerevisiae uracil 3 (URA3); stuffer fragment |
| Promoter: | Phage T7 gene 10 promoter (T7g10) Phage T3 promoter Escherichia coli lac operon promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pBluesScriptIIKS |
| Further information: | The plasmid was constructed by PCR amplifying a 522 bp fragment of the S. cerevisiae URA3 gene from pNKY51 and cloning it as a SacI/KpnI fragment into the SacI/KpnI opened pBlueScriptIIKS vector. The URA3 stuffer fragment can be removed using XcmI, which produces 3' T overhangs that can be used for cloning PCR products derived from amplification by Taq polymerase. Alternatively, the stuffer fragment can be removed using EcoRV, which yields blunt-ends suitable for cloning PCR products generated by Pfu DNA polymerase. The vector is suitable for blue/white selection of transformants when using EcoRV to remove the stuffer fragment. |
| EMBL Accession number: | - |
| Latest sequence update: | 20/02/2014 |
| Sequence detail: | Primers used to amplify the URA3 stuffer fragment:
Forward: 5′ AAGGTACCGATATCTCCAATACTTGTATGGAGGGCACAGTTAAGCC
KpnI EcoRV XcmI
Reverse: 5′ AAGAGCTCGATATCCTCCAATACTCCTTTGGATCCCTTCCCTTTGCAAATAGT
SacI EcoRV XcmI |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr F. Torres(1). (1) Departamento de Biologia Celular, Universidade de Brasilia, Brasilia, Brazil |
| Plasmid reference: | Janner et al., Springerplus 2:441 (2013) [PMID: 24058893] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pPCV (LMBP 9004) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr F. Torres and was published in Janner et al., 2013. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.