Last data update: 24 January 2024 16:39 CET
Plasmid name: pPLcA1 (LMBP 2469)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p2469.gb
(View with Genome Compiler) p2469.txt p2469.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human Hepatitis B core protein gene (HBc); synthetic sequence |
| Promoter: | Phage λ major leftward promoter (λ PL) |
| Ribosome binding site: |
Ribosome binding site (RBS) of the phage MS2 polymerase gene |
| Terminator: | Synthetic polyadenylation signal (polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
| Parental clone: | pSP64; pPLc245 |
| Further information: | The construction of the plasmid is described in Nassal (1988). The hepatitis B core protein gene (HBc) carries a modification as compared to the sequence presented in Fig. 2A in Nassal (1988): the BglII site at position 84 of HBc has been removed by a point mutation (AGATCT -> AGACCT). The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727519.1. Name mentioned in Nassal (1988) is pPLc3-2/1. |
| EMBL Accession number: | M20706, view at EMBL, GenBank, DDBJ LT727519.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 03/12/1991 |
| Sequence detail: | The sequence of the synthetic terminator : 5' AGCTTCCGGGCCGGCGATAATACGCCGGCCCGTTTTTTTT 3' |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglII, BglII/NcoI, PvuI/XbaI and XbaI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr M. Nassal(1). (1) ZMBH, Heidelberg, Germany |
| Plasmid reference: | Nassal et al., Gene 66 (1988), 279-294 [PMID: 2901997] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061(λ) |
| Host reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
| Related host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pPLcA1 (LMBP 2469) is available at BCCM/GeneCorner. This plasmid was deposited by Dr M. Nassal and was published in Nassal et al., 1988. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.