Last data update: 24 January 2024 16:39 CET
Plasmid name: pPLcmuHTNF1 (LMBP 1627)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p1627.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human tumor necrosis factor cDNA (TNF); mature sequence |
| Promoter: | Phage λ major leftward promoter (λ PL) |
| Ribosome binding site: |
Ribosome binding site (RBS) of the phage Mu ner protein gene |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
| Parental clone: | pGB299; pATHTNF |
| Further information: | This plasmid was constructed as follows: - the mature human TNF cDNA was isolated from pATHTNF as an AvaI- EcoRI (filled-in) fragment - this fragment was inserted into the unique NcoI and BamHI (filled-in) sites of pGB299 after ligation of a synthetic NcoI-AvaI linker to the AvaI site of the isolated human TNF fragment. pPLcmuHTNF1 is designed for a PL-controlled expression of intracellular mature human TNF. The first 7 codons of the inserted human TNF cDNA are part of the synthetic linker. The nucleotide sequence of these codons differs from the wild type human TNF sequence, but the encoded amino acids are the same. Name mentioned in the publication is pPLcmu-hTNF1. Other names of the plasmid are pPLcmuHTNF11 and pPLc236muHTNF1. |
| EMBL Accession number: | X01394, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 28/08/1990 |
| Sequence detail: | Nucleotide sequence at the start of the mature human TNF DNA:
wild type human TNF
preseq. -->|--> mature sequence
5' GCC.CAG.GCA|GTC.AGA.TCA.TCT.TCT.CGA.ACC.CCG.AGT. 3'
Ala Gln Ala|Val Arg Ser Ser Ser Arg Thr Pro Ser
AvaI
sequence in pPLcmuHTNF1
Mu-NER ->| |-->mature hTNF
5' TTTTACC.ATG.GTA.CGT.TCT.TCC.TCT.CGT.ACC.CCG.AGT. 3'
Met Val Arg Ser Ser Ser Arg Thr Pro Ser
NcoI AvaI
NcoI-AvaI linker:
5' CATGGTACGTTCTTCCTCTCGTACC 3'
3' CATGCAAGAAGGAGAGCATGGGGCT 5' |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr E. Remaut(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Marmenout et al., Eur. J. Biochem. 152 (1985), 515-522 [PMID: 3932069] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061(λ) |
| Host reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
| Related host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pPLcmuHTNF1 (LMBP 1627) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr E. Remaut and was published in Marmenout et al., 1985. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.