GREAT AT SMALL THINGS

14

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pPLcmuHTNF1 (LMBP 1627)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p1627.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human tumor necrosis factor cDNA (TNF); mature sequence
Promoter: Phage λ major leftward promoter (λ PL)
Ribosome
binding site:
Ribosome binding site (RBS) of the phage Mu ner protein gene
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pGB299; pATHTNF
Further information: This plasmid was constructed as follows:
- the mature human TNF cDNA was isolated from pATHTNF as an AvaI- EcoRI (filled-in) fragment
- this fragment was inserted into the unique NcoI and BamHI (filled-in) sites of pGB299 after ligation of a synthetic NcoI-AvaI linker to the AvaI site of the isolated human TNF fragment.
pPLcmuHTNF1 is designed for a PL-controlled expression of intracellular mature human TNF.
The first 7 codons of the inserted human TNF cDNA are part of the synthetic linker. The nucleotide sequence of these codons differs from the wild type human TNF sequence, but the encoded amino acids are the same.
Name mentioned in the publication is pPLcmu-hTNF1.
Other names of the plasmid are pPLcmuHTNF11 and pPLc236muHTNF1.
EMBL Accession number: X01394, view at EMBL, GenBank, DDBJ
Latest sequence update: 28/08/1990
Sequence detail:
Nucleotide sequence at the start of the mature human TNF DNA:

wild type human TNF

    preseq. -->|--> mature sequence
 5' GCC.CAG.GCA|GTC.AGA.TCA.TCT.TCT.CGA.ACC.CCG.AGT. 3'
    Ala Gln Ala|Val Arg Ser Ser Ser Arg Thr Pro Ser
                                         AvaI

sequence in pPLcmuHTNF1

Mu-NER ->|     |-->mature hTNF
 5' TTTTACC.ATG.GTA.CGT.TCT.TCC.TCT.CGT.ACC.CCG.AGT. 3'
            Met Val Arg Ser Ser Ser Arg Thr Pro Ser
         NcoI                             AvaI



NcoI-AvaI linker:

5' CATGGTACGTTCTTCCTCTCGTACC     3'
3'     CATGCAAGAAGGAGAGCATGGGGCT 5'
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr E. Remaut(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Marmenout et al., Eur. J. Biochem. 152 (1985), 515-522 [PMID: 3932069]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061(λ)
Host reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Related host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pPLcmuHTNF1 (LMBP 1627) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr E. Remaut and was published in Marmenout et al., 1985.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search