Last data update: 24 January 2024 16:39 CET
Plasmid name: pSP64GAL1m (LMBP 2118)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p2118.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
- |
Promoter: | Phage SP6 promoter Escherichia coli lac operon promoter Saccharomyces cerevisiae galactokinase promoter (GAL1) |
Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
Terminator: | - |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli |
Parental clone: | pSP64GAL1 |
Further information: | The plasmid was constructed as follows: 1) pUDHIL208 was cleaved with SalI and filled in with Klenow DNA polymerase; 2) BamHI linkers ('CGGGATCCCG') were ligated; 3) This construction was then cut with BamHI to remove the BamHI fragment, containing the hIL2 gene. This plasmid contains a dominant selection marker for integrative transformation (e.g. in Ty1 after cleavage with ClaI or XhoI). This plasmid is a mutated variant of pSP64GAL1: in and near the start codon of the GAL1 gene, three nucleotides were changed, which resulted in the loss of this codon, and the creation of a second PvuI site. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence at the 3' end of the GAL1 promoter is not exactly known. Other name of the plasmid is pSP64Gal1-1. |
EMBL Accession number: | - |
Latest sequence update: | 13/02/1990 |
Sequence detail: | Nucleotide sequence around the start codon of GAL1 : GAL1: 5' AAAAAACTATA ATG.ACT.AAA 3' Mutated GAL1: 5' AAAAAACGATCGTGACTAAA 3' * ** PvuI *: Mutated nucleotide. |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by J. Demolder(1) and Prof. Dr R. Contreras(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSP64GAL1m (LMBP 2118) is available at BCCM/GeneCorner. This plasmid was deposited by J. Demolder and Prof. Dr R. Contreras. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.