Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV-Sport-Fluc-PITSLRE-LacZ (LMBP 5262)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5262.gb
(View with Genome Compiler) p5262.txt p5262.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+)) Escherichia coli lac Z gene (lacZ); with modified 5' end and missing the EcoRI site at the 3' end |
Promoter: | Phage SP6 promoter Phage T7 gene 10 promoter (T7g10) Escherichia coli lac operon promoter; mutant (lacUV5) Simian virus 40 early promoter (SV40 early) |
Ribosome binding site: |
Internal ribosome entry site (IRES), i.e. Di-1 fragment, of the human PITSLRE kinase gene (CDC2L2, CDK11, p110 PITSLRE; expressing the β SV3 isoform) |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pSV SPORT 1; pIRES-lacZ; pUC19; pGL3-Basic |
Further information: | The construction of the plasmid is described in Cornelis et al. (2000). pSV-Sport-Fluc-PITSLRE-LacZ is a dicistronic expression vector with the internal ribosome entry site (IRES) of the human CDC2L2 gene, i.e. the Di-1 fragment of p110 PITSLRE, in the intercistronic region between upstream LUCm and downstream lacZ coding sequences. The IRES can drive translation of the downstream lacZ sequence independently of the 5'-cap structure bound to the 5'-end of the mRNA molecule. As compared to the wild type sequence, lacZ shows some modifications at the N-terminus, and the EcoRI site at the 3' end is removed. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726991.1. The nucleotide sequence of the PITSLRE-Di-1 IRES corresponds with the EMBL Nucleotide Sequence Database accession number AF067521.1, adapted to the BCCM/GeneCorner sequence analysis results of the XbaI/NcoI IRES fragment. The following difference is observable: the nucleotide T at position 892 of the CDC2L2 coding sequence is substituted by a C-residue. Name mentioned in Cornelis et al. (2000) is Di-1. Other name of the plasmid is pSVSportFlucPITSLRELacz. |
EMBL Accession number: | AF067521.1, view at EMBL, GenBank, DDBJ LT726991.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 15/05/2008 |
Sequence detail: | Primers used to amplify the Di-1 PITSLRE IRES fragment: |-> Di-1 forward: 5' CTAGTCTAGA|AAAGTGAAAACTTTAGATGAAATTC 3' XbaI |-> Di-1 reverse: 5' TTCTTCATCTTCACCCATGG|CTTCCTCACTTAC 3' NcoI |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AvaII, KpnI, KpnI/SalI, NcoI/XbaI and SalI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Y. Bruynooghe(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Cornelis et al., Mol. Cell 5 (2000), 597-605 [PMID: 10882096] |
Related plasmid reference: | Sherf et al., Promega Notes Magazine 49 (1994), 14-21 |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Related website: | http://www.iresite.org/IRESite_web.php?page=view&entry_id=436 |
Refer in your Materials and Methods: |
pSV-Sport-Fluc-PITSLRE-LacZ (LMBP 5262) is available at BCCM/GeneCorner. This plasmid was deposited by Y. Bruynooghe and Prof. Dr R. Beyaert and was published in Cornelis et al., 2000. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.