Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV-Sport-di-FR-HIF (LMBP 5202)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p5202.gb
(View with Genome Compiler) p5202.txt p5202.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+)) Renilla reniformis luciferase gene (rLUC) |
| Promoter: | Phage SP6 promoter Phage T7 gene 10 promoter (T7g10) Escherichia coli lac operon promoter; mutant (lacUV5) Simian virus 40 early promoter (SV40 early) |
| Ribosome binding site: |
Internal ribosome entry site (IRES) of the mouse hypoxia-inducible factor-1 α subunit (HIF-1α) |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pSV-Sport-Rluc; pUC18; pGL3-Basic; pSV SPORT 1 |
| Further information: | The construction of the plasmid is described in Schepens et al. (2005). pSV-Sport-di-FR-HIF is a dicistronic expression vector with the internal ribosome entry site (IRES) of the mouse HIF-1α subunit in the intercistronic region between upstream LUCm and downstream rLUC coding sequences. The IRES can drive translation of the downstream rLUC sequence independently of the 5'-cap structure bound to the 5'-end of the mRNA molecule. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726961.1. The nucleotide sequence of the mHIF-1α 5' UTR corresponds with the EMBL Nucleotide Sequence Database accession number Y13656.1. Name mentioned in Schepens et al. (2005) is Di-HIF. |
| EMBL Accession number: | Y13656.1, view at EMBL, GenBank, DDBJ LT726961.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 01/12/2006 |
| Sequence detail: | The primers used in PCR to amplify HIF-1alpha IRES were:
forward: 5'TCTAGTCTAGAAAGCAGGGTGGTAACAACGCAGAGTAC3'
XbaI
reverse: 5'TCTAGCCATGGCGAATCGGTGCCCGCGTTGTCTTCCCG3'
NcoI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: EcoRI, KpnI, NcoI/XbaI and PaeI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr B. Schepens(1) (2) and Prof. Dr R. Beyaert(1) (2). It was constructed by Y. Bruynooghe(1) (2) . (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Schepens et al., Nucleic Acids Res. 33 (2005), 6884-6894 [PMID: 16396835] |
| Related plasmid reference: | Sherf et al., Promega Notes Magazine 49 (1994), 14-21 |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
| Related website: | http://www.iresite.org/IRESite_web.php?page=view&entry_id=1 |
Refer in your Materials and Methods: |
pSV-Sport-di-FR-HIF (LMBP 5202) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. Schepens and Prof. Dr R. Beyaert and was published in Schepens et al., 2005. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.