GREAT AT SMALL THINGS

6

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pSV-Sport-di-FR-HIF (LMBP 5202)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p5202.gb (View with Genome Compiler)
p5202.txt
p5202.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+))
Renilla reniformis luciferase gene (rLUC)
Promoter: Phage SP6 promoter
Phage T7 gene 10 promoter (T7g10)
Escherichia coli lac operon promoter; mutant (lacUV5)
Simian virus 40 early promoter (SV40 early)
Ribosome
binding site:
Internal ribosome entry site (IRES) of the mouse hypoxia-inducible factor-1 α subunit (HIF-1α)
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pSV-Sport-Rluc; pUC18; pGL3-Basic; pSV SPORT 1
Further information: The construction of the plasmid is described in Schepens et al. (2005).
pSV-Sport-di-FR-HIF is a dicistronic expression vector with the internal ribosome entry site (IRES) of the mouse HIF-1α subunit in the intercistronic region between upstream LUCm and downstream rLUC coding sequences. The IRES can drive translation of the downstream rLUC sequence independently of the 5'-cap structure bound to the 5'-end of the mRNA molecule.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726961.1.
The nucleotide sequence of the mHIF-1α 5' UTR corresponds with the EMBL Nucleotide Sequence Database accession number Y13656.1.
Name mentioned in Schepens et al. (2005) is Di-HIF.
EMBL Accession number: Y13656.1, view at EMBL, GenBank, DDBJ
LT726961.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 01/12/2006
Sequence detail:
The primers used in PCR to amplify HIF-1alpha IRES were:  

forward: 5'TCTAGTCTAGAAAGCAGGGTGGTAACAACGCAGAGTAC3'
                XbaI

reverse: 5'TCTAGCCATGGCGAATCGGTGCCCGCGTTGTCTTCCCG3'
                NcoI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: EcoRI, KpnI, NcoI/XbaI and PaeI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr B. Schepens(1) (2) and Prof. Dr R. Beyaert(1) (2). It was constructed by Y. Bruynooghe(1) (2) .
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Schepens et al., Nucleic Acids Res. 33 (2005), 6884-6894 [PMID: 16396835]
Related plasmid reference: Sherf et al., Promega Notes Magazine 49 (1994), 14-21
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -
Related website: http://www.iresite.org/IRESite_web.php?page=view&entry_id=1

Refer in your Materials and Methods:

pSV-Sport-di-FR-HIF (LMBP 5202) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. Schepens and Prof. Dr R. Beyaert and was published in Schepens et al., 2005.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search