Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV-Sport-di-FR-HIFdel1 (LMBP 5203)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5203.gb
(View with Genome Compiler) p5203.txt p5203.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+)) Renilla reniformis luciferase gene (rLUC) |
Promoter: | Phage SP6 promoter Phage T7 gene 10 promoter (T7g10) Escherichia coli lac operon promoter; mutant (lacUV5) Simian virus 40 early promoter (SV40 early) |
Ribosome binding site: |
Internal ribosome entry site (IRES) of the mouse hypoxia-inducible factor-1 α subunit (HIF-1α); 3' most half fragment (HIFdel1) |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pSV SPORT 1; pGL3-Basic; pUC18; pSV-Sport-Rluc |
Further information: | The plasmid was constructed by two successive three-point ligations as follows: (i) the PCR amplified HIFdel1 IRES fragment was digested with XbaI-NcoI and cloned together with the Renilla luciferase coding region, obtained as an NcoI-EcoRI fragment from pSV-Sport-Rluc, into the XbaI-EcoRI opened pUC18 vector; (ii) the IRES-Renilla luciferase insert was digested with XbaI-EcoRI and ligated to both the firefly luciferase coding region, obtained as a KpnI-XbaI fragment from pGL3-Basic, and the KpnI-EcoRI opened pSV SPORT 1 expression vector. pSV-Sport-di-FR-HIFdel1 is a dicistronic expression vector with the 3' most half of the internal ribosome entry site (IRES) of the mouse HIF-1α subunit in the intercistronic region between upstream LUCm and downstream rLUC coding sequences. The IRES can drive translation of the downstream rLUC sequence independently of the 5'-cap structure bound to the 5'-end of the mRNA molecule. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726962.1. The nucleotide sequence of the mouse HIFdel1 corresponds with the EMBL Nucleotide Sequence Database accession number Y13656.1. Name mentioned in Schepens et al. (2005) is Di-HIFdel1. |
EMBL Accession number: | Y13656.1, view at EMBL, GenBank, DDBJ LT726962.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 04/01/2007 |
Sequence detail: | The primers used in PCR to amplify HIFdel1 were: forward 5' CTAGTCTAGACCTAGGAACCCGAGCCGGAGCTCAGCG 3' *1 XbaI reverse 5' TCTAGCCATGGCGAATCGGTGCCCGCGTTGTCTTCCCG 3' *2 NcoI *1: This primer was used instead of primer I described in Schepens et al. (2005) (B. Schepens, personal communication). *2: Primer F (Schepens et al., Nucl. Acids Res. 33 (2005), 6884-6894) |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: NcoI/XbaI, PaeI and PdiI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr B. Schepens(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Schepens et al., Nucleic Acids Res. 33 (2005), 6884-6894 [PMID: 16396835] |
Related plasmid reference: | Sherf et al., Promega Notes Magazine 49 (1994), 14-21 |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Related website: | http://www.iresite.org/IRESite_web.php?page=view&entry_id=1 |
Refer in your Materials and Methods: |
pSV-Sport-di-FR-HIFdel1 (LMBP 5203) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. Schepens and Prof. Dr R. Beyaert and was published in Schepens et al., 2005. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.