Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV23SIVHA8 (LMBP 2186)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p2186.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Influenza A virus (A/Victoria/3/1975(H3N2)) haemagglutinin cDNA (HA, IVHA) |
| Promoter: | Simian virus 40 early promoter (SV40 early) |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pSV23S; pUR250IVHA8 |
| Further information: | HA1 cDNA was isolated as a SalI fragment from pUR250IVHA8, and was inserted anticlockwise into the unique SalI site of pSV23S. This plasmid contains theSV40 small t-antigen splicing signal. This clone only differs in the 5' UTR region of IVHA from pSV23SIVHA, where it contains two nucleotides more. Other name of the plasmid is pSV23SHA8m. |
| EMBL Accession number: | - |
| Latest sequence update: | 05/03/1990 |
| Sequence detail: | Nucleotide sequence between the SalI site and the start codon of the IVHA gene:
IVHA1 GTCGACCGGGATAATTCTATTAACC ATG.AAG.ACT
SalI *
IVHA8 GTCGACCGATAATTCTATTAACC ATG.AAG.ACT
SalI *
*: Start codon of the IVHA gene. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by G. Maertens(1) and Prof. Dr W. Min Jou(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Huylebroeck et al., Gene 66 (1988), 163-181 [PMID: 2844629] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061(λ) |
| Host reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
| Related host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSV23SIVHA8 (LMBP 2186) is available at BCCM/GeneCorner. This plasmid was deposited by G. Maertens and Prof. Dr W. Min Jou. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.