GREAT AT SMALL THINGS

9

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pSV23SIVHA8 (LMBP 2186)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p2186.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Influenza A virus (A/Victoria/3/1975(H3N2)) haemagglutinin cDNA (HA, IVHA)
Promoter: Simian virus 40 early promoter (SV40 early)
Ribosome
binding site:
-
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pSV23S; pUR250IVHA8
Further information: HA1 cDNA was isolated as a SalI fragment from pUR250IVHA8, and was inserted anticlockwise into the unique SalI site of pSV23S.
This plasmid contains theSV40 small t-antigen splicing signal.
This clone only differs in the 5' UTR region of IVHA from pSV23SIVHA, where it contains two nucleotides more.
Other name of the plasmid is pSV23SHA8m.
EMBL Accession number: -
Latest sequence update: 05/03/1990
Sequence detail:
Nucleotide sequence between the SalI site and the start codon of the IVHA gene:


IVHA1               GTCGACCGGGATAATTCTATTAACC ATG.AAG.ACT
                    SalI                      *

IVHA8               GTCGACCGATAATTCTATTAACC ATG.AAG.ACT
                    SalI                    *

*: Start codon of the IVHA gene.
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by G. Maertens(1) and Prof. Dr W. Min Jou(1).
(1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Huylebroeck et al., Gene 66 (1988), 163-181 [PMID: 2844629]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061(λ)
Host reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Related host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pSV23SIVHA8 (LMBP 2186) is available at BCCM/GeneCorner. This plasmid was deposited by G. Maertens and Prof. Dr W. Min Jou.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search