Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV58 (LMBP 1836)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | psv58.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
- |
| Promoter: | Simian virus 40 late promoter (SV40 late) Simian virus 40 early promoter (SV40 early) |
| Ribosome binding site: |
- |
| Terminator: | Phage fd terminator Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pSV54; pPLc2833FdT1 |
| Further information: | The plasmid was constructed by inserting the BamHI fragment of pPLc2833FdT1, containing the lac operator and the fd terminator, in the unique BamHI site of pSV54. Because of the presence of the Lac operator, Lac+ E. coli host cells turn blue on X-Gal. See also pSV54 for basic constructions and pSV529 for other remarks. Other name of the plasmid is pSV53110. |
| EMBL Accession number: | - |
| Latest sequence update: | 28/11/1989 |
| Sequence detail: | Nucleotide sequence of the inserted BamHI fragment:
5' GGATCCGGGGTCGGCTGCAGCCTCTAGAGGGTCGACCCTCTAGAGGG...fd...lac operator...
BamHI PstI XbaI SalI XbaI
TCGACCTCTAGAGGGTCGACCCTCTAGAGCCGGATCCGGA 3'
XbaI SalI XbaI BamHI
BspMII |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by G. Maertens(1) and Prof. Dr W. Min Jou(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Huylebroeck et al., Gene 66 (1988), 163-181 [PMID: 2844629] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli W6 (λrex) |
| Host reference: | - |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSV58 (LMBP 1836) is available at BCCM/GeneCorner. This plasmid was deposited by G. Maertens and Prof. Dr W. Min Jou and was published in Huylebroeck et al., 1988. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.