Last data update: 24 January 2024 16:39 CET
Plasmid name: pUCmini (LMBP 9221)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p9221.gb
(View with Genome Compiler) p9221.txt p9221.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
- |
| Promoter: | - |
| Ribosome binding site: |
- |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pUC18deltaLacZ |
| Further information: | The plasmid was constructed by removing the lac promoter and additional DNA between the pMB1 ori and multicloning site by PCR amplifying the backbone of pUC18deltaLacZ. The resulting PCR product was purified from the original template by digestion with DpnI and circularised by T4 DNA ligase. This plasmid is meant as a general cloning vector with an extended multicloning site. It can be used to clone custom promoters and terminators before and after the cloned gene. |
| EMBL Accession number: | - |
| Latest sequence update: | 05/06/2014 |
| Sequence detail: | Primers used to construct pUCmini:
Forward: 5' GTGGGCCCGTTTAAACACATGTGAGCAAAAGGCCAG
ApaI PmeI
Reverse: 5' TAGTCTCGAGGATATCCGAATTCGAGCTCGGTAC
XhoI EcoRV EcoRI SacI KpnI
Multicloning site of pUCmini:
5' ACGCGTCGCGAGGCCATATGGGTTAACCCATGGCCAAGCTTGC
MluI NruI NdeI HpaI NcoI HindIII
MscI
ATGCCTGCAGGTCGACTCTAGAGGATCC 3'
PstI SalI XbaI BamHI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglI/PvuI/XbaI, DraI and HindIII. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Inflammation Research Center, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Staal et al., BioTechniques 66 (2019), 254-259 [PMID: 31124712] [DOI: 10.2144/btn-2019-0014] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pUCmini (LMBP 9221) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert and was published in Staal et al., 2019. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.